National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 13570R-3 
 Symbol spag  Full Name spaghetti 
 CG No CG13570  Old CG No CG13570 
 Synonyms l(2)k12101, CG13570, spag 
 Accession No (Link to NCBI) NM_079925.2 
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees semi-lethal 
 Map Viewer
 Reference
[Please submit your publication]
Rauskolb C, Pan G, Reddy BV, Oh H, Irvine KD.
Zyxin links fat signaling to the hippo pathway.
PLoS Biol. (2011) 9(6) e1000624 [ PubMed ID = 21666802 ] [ RRC reference ]

Tiwari P, Kumar A, Das RN, Malhotra V, VijayRaghavan K.
A Tendon Cell Specific RNAi Screen Reveals Novel Candidates Essential for Muscle Tendon Interaction.
PLoS ONE (2015) 10(10) e0140976 [ PubMed ID = 26488612 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgTTACCACATTAACCGGGCACT 
 Primer Seq. 3'
aatctagaggtaccGCGTCGGCTTTGGATTTGTTT 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 TTACCACATT AACCGGGCAC TGTGCTACCT AAAACAGGAG AGCTTTGATC AATGCGTGGA 
0061 GGACTGCGAG GCCGCCATTG CGCTGGATAA GCTCTGCGTG AAAGCTTACT ACCGGCGAAT 
0121 GCAGGCNCAA CGAGTCCCTG GGCAACAACA TGGAAGCCCT GAAGGATTGC ACCACTGTGC 
0181 TGGCCATCGA GCCGAAGAAC ATCGAGGCCA AGAGGAGCCT GGCCAGAATC AACGACCGTC 
0241 TGCGCAAGAT TGCCACCAAA AGTGGGCCAA ACTTTACACC CGATCGTCCT GGCATGATTG 
0301 AGATCTTGCC AATCGAGAAG CCTGCTTATA AACGCTCCAA GAAGGCAATG CGCAGTGTTC 
0361 CCGTTGTAGA CGTGGTATCT CCTCGTGCTA CCATCGATGA TAGCATNCAC CAACTACGCA 
0421 TTTCGGATGA GGACATAGAT AAGATATTTA GATAGTAACT GCGGCATAAT CGAAGAGGTC 
0481 AAAAAAACAA ATCCAAACGG CCTGACGC 
 in silico PCR Fragment
0001 TTACCACATT AACCGGGCAC TGTGCTACCT AAAACAGGAG AGCTTTGATC AATGCGTGGA 
0061 GGACTGCGAG GCCGCCATTG CGCTGGATAA GCTCTGCGTG AAAGCTTACT ACCGGCGAAT 
0121 GCAGGC-CAA CGAGTCCCTG GGCAACAACA TGGAAGCCCT GAAGGATTGC ACCACTGTGC 
0181 TGGCCATCGA GCCGAAGAAC ATCGAGGCCA AGAGGAGCCT GGCCAGAATC AACGACCGTC 
0241 TGCGCAAGAT TGCCACCAAA AGTGGGCCAA ACTTTACACC CGATCGTCCT GGCATGATTG 
0301 AGATCTTGCC AATCGAGAAG CCTGCTTATA AACGCTCCAA GAAGGCAATG CGCAGTGTTC 
0361 CCGTTGTAGA CGTGGTATCT CCTCGTGCTA CCATCGATGA TAGCA---AC CAACTACGCA 
0421 TTTCGGATGA GGACATAGAT AAGATATTTA -ATAGTAACT GCGGCATAAT CGAAGAGGTC 
0481 AAAAAAACAA ATCCAAA--G CC-GACGC 
 Assemble Data

13570R-3.IR_full       1   TTACCACATTAACCGGGCACTGTGCTACCTAAAACAGGAGAGCTTTGATCAATGCGTGGA 60
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
13570R-3.in silico     1   TTACCACATTAACCGGGCACTGTGCTACCTAAAACAGGAGAGCTTTGATCAATGCGTGGA 60


13570R-3.IR_full       61  GGACTGCGAGGCCGCCATTGCGCTGGATAAGCTCTGCGTGAAAGCTTACTACCGGCGAAT 120
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
13570R-3.in silico     61  GGACTGCGAGGCCGCCATTGCGCTGGATAAGCTCTGCGTGAAAGCTTACTACCGGCGAAT 120


13570R-3.IR_full       121 GCAGGCNCAACGAGTCCCTGGGCAACAACATGGAAGCCCTGAAGGATTGCACCACTGTGC 180
                           |||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||
13570R-3.in silico     121 GCAGGC-CAACGAGTCCCTGGGCAACAACATGGAAGCCCTGAAGGATTGCACCACTGTGC 180


13570R-3.IR_full       181 TGGCCATCGAGCCGAAGAACATCGAGGCCAAGAGGAGCCTGGCCAGAATCAACGACCGTC 240
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
13570R-3.in silico     181 TGGCCATCGAGCCGAAGAACATCGAGGCCAAGAGGAGCCTGGCCAGAATCAACGACCGTC 240


13570R-3.IR_full       241 TGCGCAAGATTGCCACCAAAAGTGGGCCAAACTTTACACCCGATCGTCCTGGCATGATTG 300
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
13570R-3.in silico     241 TGCGCAAGATTGCCACCAAAAGTGGGCCAAACTTTACACCCGATCGTCCTGGCATGATTG 300


13570R-3.IR_full       301 AGATCTTGCCAATCGAGAAGCCTGCTTATAAACGCTCCAAGAAGGCAATGCGCAGTGTTC 360
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
13570R-3.in silico     301 AGATCTTGCCAATCGAGAAGCCTGCTTATAAACGCTCCAAGAAGGCAATGCGCAGTGTTC 360


13570R-3.IR_full       361 CCGTTGTAGACGTGGTATCTCCTCGTGCTACCATCGATGATAGCATNCACCAACTACGCA 420
                           |||||||||||||||||||||||||||||||||||||||||||||   ||||||||||||
13570R-3.in silico     361 CCGTTGTAGACGTGGTATCTCCTCGTGCTACCATCGATGATAGCA---ACCAACTACGCA 420


13570R-3.IR_full       421 TTTCGGATGAGGACATAGATAAGATATTTAGATAGTAACTGCGGCATAATCGAAGAGGTC 480
                           |||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||
13570R-3.in silico     421 TTTCGGATGAGGACATAGATAAGATATTTA-ATAGTAACTGCGGCATAATCGAAGAGGTC 480


13570R-3.IR_full       481 AAAAAAACAAATCCAAACGGCCTGACGC 508
                           |||||||||||||||||  ||| |||||
13570R-3.in silico     481 AAAAAAACAAATCCAAA--GCC-GACGC 508

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_079925.2  CG13570-RA (spag), mRNA 
0   NM_138102.1  CG13588-RA (CG13588), mRNA 
0   NM_205968.1  CG6214-RL, transcript variant L (MRP), mRNA 
0   NM_205971.1  CG6214-RI, transcript variant I (MRP), mRNA 
0   NM_135747.3  CG6214-RB, transcript variant B (MRP), mRNA 
0   NM_205969.1  CG6214-RK, transcript variant K (MRP), mRNA 
0   NM_205981.1  CG6214-RN, transcript variant N (MRP), mRNA 
0   NM_205970.1  CG6214-RJ, transcript variant J (MRP), mRNA 
0   NM_205972.1  CG6214-RH, transcript variant H (MRP), mRNA 
0   NM_205979.1  CG6214-RP, transcript variant P (MRP), mRNA 
0   NM_205973.1  CG6214-RG, transcript variant G (MRP), mRNA 
0   NM_165020.2  CG6214-RA, transcript variant A (MRP), mRNA 
0   NM_205977.1  CG6214-RC, transcript variant C (MRP), mRNA 
0   NM_205974.1  CG6214-RF, transcript variant F (MRP), mRNA 
0   NM_205975.1  CG6214-RE, transcript variant E (MRP), mRNA 
0   NM_205976.1  CG6214-RD, transcript variant D (MRP), mRNA 
0   NM_205980.1  CG6214-RO, transcript variant O (MRP), mRNA 
0   NM_205978.1  CG6214-RQ, transcript variant Q (MRP), mRNA 
0   NM_205982.1  CG6214-RM, transcript variant M (MRP), mRNA 
0   NM_133069.1  CG6367-RA (psh), mRNA 
0   NM_080047.2  CG8491-RA (kto), mRNA 
0   NM_165225.1  CG7100-RB, transcript variant B (CadN), mRNA 
0   NM_165226.1  CG7100-RF, transcript variant F (CadN), mRNA 
0   NM_165227.1  CG7100-RD, transcript variant D (CadN), mRNA 
0   NM_165228.1  CG7100-RC, transcript variant C (CadN), mRNA 
0   NM_165229.1  CG7100-RA, transcript variant A (CadN), mRNA 
0   NM_165230.1  CG7100-RG, transcript variant G (CadN), mRNA 
0   NM_165231.1  CG7100-RE, transcript variant E (CadN), mRNA 
0   NM_001032108.1  CG7100-RJ, transcript variant J (CadN), mRNA 
0   NM_001032109.1  CG7100-RI, transcript variant I (CadN), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.