National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock temporarily unavailable request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 13570R-1 
 Symbol spag  Full Name spaghetti 
 CG No CG13570  Old CG No CG13570 
 Synonyms l(2)k12101, CG13570, spag 
 Accession No (Link to NCBI) NM_079925.2 
 Inserted Chr. ll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
[Please submit your publication]
Rauskolb C, Pan G, Reddy BV, Oh H, Irvine KD.
Zyxin links fat signaling to the hippo pathway.
PLoS Biol. (2011) 9(6) e1000624 [ PubMed ID = 21666802 ] [ RRC reference ]

Umemori M, Habara O, Iwata T, Maeda K, Nishinoue K, Okabe A, Takemura M, Takahashi K, Saigo K, Ueda R, Adachi-Yamada T.
RNAi-mediated knockdown showing impaired cell survival in Drosophila wing imaginal disc.
Gene Regul Syst Bio (2009) 3 11-20 [ PubMed ID = 19838331 ] [ RRC reference ]

Tiwari P, Kumar A, Das RN, Malhotra V, VijayRaghavan K.
A Tendon Cell Specific RNAi Screen Reveals Novel Candidates Essential for Muscle Tendon Interaction.
PLoS ONE (2015) 10(10) e0140976 [ PubMed ID = 26488612 ] [ RRC reference ]  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
 Primer Seq. 3'
 Predicted Fragment Size
 IR fragment full Seq
 in silico PCR Fragment
 Assemble Data

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     1   TTACCACATTAACCGGGCACTGTGCTACCTAAAACAGGAGAGCTTTGATCAATGCGTGGA 60

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     61  GGACTGCGAGGCCGCCATTGCGCTGGATAAGCTCTGCGTGAAAGCTTACTACCGGCGAAT 120

                           |||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     121 GCAGGC-CAACGAGTCCCTGGGCAACAACATGGAAGCCCTGAAGGATTGCACCACTGTGC 180

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     181 TGGCCATCGAGCCGAAGAACATCGAGGCCAAGAGGAGCCTGGCCAGAATCAACGACCGTC 240

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     241 TGCGCAAGATTGCCACCAAAAGTGGGCCAAACTTTACACCCGATCGTCCTGGCATGATTG 300

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     301 AGATCTTGCCAATCGAGAAGCCTGCTTATAAACGCTCCAAGAAGGCAATGCGCAGTGTTC 360

                           |||||||||||||||||||||||||||||||||||||||||||||   |||||||||||| silico     361 CCGTTGTAGACGTGGTATCTCCTCGTGCTACCATCGATGATAGCA---ACCAACTACGCA 420

                           |||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| silico     421 TTTCGGATGAGGACATAGATAAGATATTTA-ATAGTAACTGCGGCATAATCGAAGAGGTC 480

                           |||||||||||||||||  ||| ||||| silico     481 AAAAAAACAAATCCAAA--GCC-GACGC 508

 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_079925.2  CG13570-RA (spag), mRNA 
0   NM_138102.1  CG13588-RA (CG13588), mRNA 
0   NM_205968.1  CG6214-RL, transcript variant L (MRP), mRNA 
0   NM_205971.1  CG6214-RI, transcript variant I (MRP), mRNA 
0   NM_135747.3  CG6214-RB, transcript variant B (MRP), mRNA 
0   NM_205969.1  CG6214-RK, transcript variant K (MRP), mRNA 
0   NM_205981.1  CG6214-RN, transcript variant N (MRP), mRNA 
0   NM_205970.1  CG6214-RJ, transcript variant J (MRP), mRNA 
0   NM_205972.1  CG6214-RH, transcript variant H (MRP), mRNA 
0   NM_205979.1  CG6214-RP, transcript variant P (MRP), mRNA 
0   NM_205973.1  CG6214-RG, transcript variant G (MRP), mRNA 
0   NM_165020.2  CG6214-RA, transcript variant A (MRP), mRNA 
0   NM_205977.1  CG6214-RC, transcript variant C (MRP), mRNA 
0   NM_205974.1  CG6214-RF, transcript variant F (MRP), mRNA 
0   NM_205975.1  CG6214-RE, transcript variant E (MRP), mRNA 
0   NM_205976.1  CG6214-RD, transcript variant D (MRP), mRNA 
0   NM_205980.1  CG6214-RO, transcript variant O (MRP), mRNA 
0   NM_205978.1  CG6214-RQ, transcript variant Q (MRP), mRNA 
0   NM_205982.1  CG6214-RM, transcript variant M (MRP), mRNA 
0   NM_133069.1  CG6367-RA (psh), mRNA 
0   NM_080047.2  CG8491-RA (kto), mRNA 
0   NM_165225.1  CG7100-RB, transcript variant B (CadN), mRNA 
0   NM_165226.1  CG7100-RF, transcript variant F (CadN), mRNA 
0   NM_165227.1  CG7100-RD, transcript variant D (CadN), mRNA 
0   NM_165228.1  CG7100-RC, transcript variant C (CadN), mRNA 
0   NM_165229.1  CG7100-RA, transcript variant A (CadN), mRNA 
0   NM_165230.1  CG7100-RG, transcript variant G (CadN), mRNA 
0   NM_165231.1  CG7100-RE, transcript variant E (CadN), mRNA 
0   NM_001032108.1  CG7100-RJ, transcript variant J (CadN), mRNA 
0   NM_001032109.1  CG7100-RI, transcript variant I (CadN), mRNA 
 Wing Disc
JNK signal
Caspase-3 signal
Dcompartment   Penetrance

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.