National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 13550R-3 
 Symbol CG13550  Full Name CG13550 
 CG No CG13550  Old CG No CG13550 
 Synonyms CG13550 
 Accession No (Link to NCBI) NM_137942.1 
 Inserted Chr. ll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
 Reference
[Please submit your publication]
Saj A, Arziman Z, Stempfle D, van Belle W, Sauder U, Horn T, D├╝rrenberger M, Paro R, Boutros M, Merdes G.
A combined ex vivo and in vivo RNAi screen for notch regulators in Drosophila reveals an extensive notch interaction network.
Dev. Cell (2010) 18(5) 862-76 [ PubMed ID = 20493818 ] [ RRC reference ]

Umemori M, Habara O, Iwata T, Maeda K, Nishinoue K, Okabe A, Takemura M, Takahashi K, Saigo K, Ueda R, Adachi-Yamada T.
RNAi-mediated knockdown showing impaired cell survival in Drosophila wing imaginal disc.
Gene Regul Syst Bio (2009) 3 11-20 [ PubMed ID = 19838331 ] [ RRC reference ]

Tiwari P, Kumar A, Das RN, Malhotra V, VijayRaghavan K.
A Tendon Cell Specific RNAi Screen Reveals Novel Candidates Essential for Muscle Tendon Interaction.
PLoS ONE (2015) 10(10) e0140976 [ PubMed ID = 26488612 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgCCCAGGAGCAACCAAGATGTG 
 Primer Seq. 3'
aatctagaggtaccGATTGGTTGACTCCGGGCTGA 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 cCCAGGNAGC AACCAAGATG TGTACGCCAA GCGAAgNCGG CTGGCCGAGC GANATAGCCC 
0061 AGAACGACGA GCTGATCCGC CAGGTGAAAC AGCTGCAGGC TCAAAACAAA CAGCTGGCCG 
0121 ACCTGCAGCG CACCGCCCAA GAGGTGACGG ATCTGTACCA GAAGGAGAAG CAACAGAGGA 
0181 TCGAGCTGGA GAAGCGCACC AAGCAGATCG GTGAGCGATG CGGACAGCTG GAAAAGGAGC 
0241 TGGACGTACA GGTTGGGAAC TGCGAGAATC TGCAGGAGCA GCTGCAAGTG CGGGGACTAC 
0301 CCGTGGAAGC CAAGGATGTG CTGTCCATAC TCATGCAGTT CTCCCAGCGG CTGGGCGACG 
0361 ATTGTGGACT TTTGCGGCGG GATCAGAACA TCATGAAGAA GCTAAGGGAG CNCNGCAAGA 
0421 CTATAGACGT AAGcGTgNCC ACGCCAAAGA GCCCGAATTC ACGTAGCAAA CGGAAAGCCC 
0481 ATCAGCCCGG AGTCAACCAA TC 
 in silico PCR Fragment
0001 CCCAGG-AGC AACCAAGATG TGTACGCCAA GCGAAGCCGG CTGGCCGAGC GA-ATAGCCC 
0061 AGAACGACGA GCTGATCCGC CAGGTGAAAC AGCTGCAGGC TCAAAACAAA CAGCTGGCCG 
0121 ACCTGCAGCG CACCGCCCAA GAGGTGACGG ATCTGTACCA GAAGGAGAAG CAACAGAGGA 
0181 TCGAGCTGGA GAAGCGCACC AAGCAGATCG GCGAGCGATG CGGACAGCTG GAAAAGGAGC 
0241 TGGACGTACA GGTTGGGAAC TGCGAGAATC TGCAGGAGCA GCTGCAAGTG CGGGGACTAC 
0301 CCGTGGAAGC CAAGGATGTG CTGTCCATAC TCATGCAGTT CTCCCAGCGG CTGGGCGACG 
0361 ATTGTGGACT TTTGCGGCGG GATCAGAACA TCATGAAGAA GCTAAGGGAG CACTGCAAGA 
0421 CTATAGACGT AAGCGTGCCC ACGCCAAAGA GCCCGAATTC ACGTAGCAAA CGGAAAGCCC 
0481 ATCAGCCCGG AGTCAACCAA TC 
 Assemble Data

13550R-3.IR_full       1   CCCAGGNAGCAACCAAGATGTGTACGCCAAGCGAAGNCGGCTGGCCGAGCGANATAGCCC 60
                           |||||| ||||||||||||||||||||||||||||| ||||||||||||||| |||||||
13550R-3.in silico     1   CCCAGG-AGCAACCAAGATGTGTACGCCAAGCGAAGCCGGCTGGCCGAGCGA-ATAGCCC 60


13550R-3.IR_full       61  AGAACGACGAGCTGATCCGCCAGGTGAAACAGCTGCAGGCTCAAAACAAACAGCTGGCCG 120
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
13550R-3.in silico     61  AGAACGACGAGCTGATCCGCCAGGTGAAACAGCTGCAGGCTCAAAACAAACAGCTGGCCG 120


13550R-3.IR_full       121 ACCTGCAGCGCACCGCCCAAGAGGTGACGGATCTGTACCAGAAGGAGAAGCAACAGAGGA 180
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
13550R-3.in silico     121 ACCTGCAGCGCACCGCCCAAGAGGTGACGGATCTGTACCAGAAGGAGAAGCAACAGAGGA 180


13550R-3.IR_full       181 TCGAGCTGGAGAAGCGCACCAAGCAGATCGGTGAGCGATGCGGACAGCTGGAAAAGGAGC 240
                           ||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||
13550R-3.in silico     181 TCGAGCTGGAGAAGCGCACCAAGCAGATCGGCGAGCGATGCGGACAGCTGGAAAAGGAGC 240


13550R-3.IR_full       241 TGGACGTACAGGTTGGGAACTGCGAGAATCTGCAGGAGCAGCTGCAAGTGCGGGGACTAC 300
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
13550R-3.in silico     241 TGGACGTACAGGTTGGGAACTGCGAGAATCTGCAGGAGCAGCTGCAAGTGCGGGGACTAC 300


13550R-3.IR_full       301 CCGTGGAAGCCAAGGATGTGCTGTCCATACTCATGCAGTTCTCCCAGCGGCTGGGCGACG 360
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
13550R-3.in silico     301 CCGTGGAAGCCAAGGATGTGCTGTCCATACTCATGCAGTTCTCCCAGCGGCTGGGCGACG 360


13550R-3.IR_full       361 ATTGTGGACTTTTGCGGCGGGATCAGAACATCATGAAGAAGCTAAGGGAGCNCNGCAAGA 420
                           ||||||||||||||||||||||||||||||||||||||||||||||||||| | ||||||
13550R-3.in silico     361 ATTGTGGACTTTTGCGGCGGGATCAGAACATCATGAAGAAGCTAAGGGAGCACTGCAAGA 420


13550R-3.IR_full       421 CTATAGACGTAAGCGTGNCCACGCCAAAGAGCCCGAATTCACGTAGCAAACGGAAAGCCC 480
                           ||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||
13550R-3.in silico     421 CTATAGACGTAAGCGTGCCCACGCCAAAGAGCCCGAATTCACGTAGCAAACGGAAAGCCC 480


13550R-3.IR_full       481 ATCAGCCCGGAGTCAACCAATC 502
                           ||||||||||||||||||||||
13550R-3.in silico     481 ATCAGCCCGGAGTCAACCAATC 502

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_137942.1  CG13550-RA (CG13550), mRNA 
0   NM_001032275.1  CG33949-RA (Rgk3), mRNA 
0   NM_078492.2  CG3312-RA, transcript variant A (Rnp4F), mRNA 
0   NM_206630.1  CG3312-RB, transcript variant B (Rnp4F), mRNA 
0   NM_139676.1  CG13708-RA (CG13708), mRNA 
0   NM_176097.1  CG33131-RA (SCAP), mRNA 
0   15  NM_141666.2  CG9492-RA (CG9492), mRNA 
0   NM_133113.1  CG7378-RA (CG7378), mRNA 
0   NM_137751.3  CG10082-RB, transcript variant B (CG10082), mRNA 
0   NM_166466.2  CG10082-RA, transcript variant A (CG10082), mRNA 
0   NM_140184.2  CG7628-RA (CG7628), mRNA 
0   13  NM_176734.1  CG33206-RA, transcript variant A (l(1)G0168), mRNA 
0   13  NM_176735.1  CG33206-RB, transcript variant B (l(1)G0168), mRNA 
0   NM_170385.1  CG1957-RB, transcript variant B (CG1957), mRNA 
0   NM_143401.1  CG1957-RA, transcript variant A (CG1957), mRNA 
0   NM_206610.1  CG14047-RB, transcript variant B (CG14047), mRNA 
0   NM_130645.2  CG14047-RA, transcript variant A (CG14047), mRNA 
0   NM_168947.1  CG7139-RB, transcript variant B (CG7139), mRNA 
0   NM_141121.2  CG7139-RA, transcript variant A (CG7139), mRNA 
0   NM_165255.1  CG10283-RB, transcript variant B (CG10283), mRNA 
0   NM_136035.4  CG10283-RA, transcript variant A (CG10283), mRNA 
0   NM_167443.1  CG9198-RB, transcript variant B (shtd), mRNA 
0   NM_132797.2  CG9198-RA, transcript variant A (shtd), mRNA 
0   NM_166682.1  CG3691-RA, transcript variant A (Pof), mRNA 
0   NM_079127.2  CG3691-RB, transcript variant B (Pof), mRNA 
0   NM_134816.2  CG31679-RA (CG31679), mRNA 
0   10  NM_132578.1  CG11146-RA (CG11146), mRNA 
0   12  NM_080157.2  CG11648-RB, transcript variant B (Abd-B), mRNA 
0   NM_080358.2  CG1484-RA (fliI), mRNA 
0   NM_079821.2  CG1954-RA (Pkc98E), mRNA 
 Wing Disc
GFP
Puc
Caspase
DAPI
Merge
Figure
JNK signal
N
DB
++ 
DC
DM
+- 
VM
 
VB
 
Caspase-3 signal
N
DB
++  
DC
DM
VM
VB
Dcompartment   Penetrance
   

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.