National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 13550R-2 
 Symbol CG13550  Full Name CG13550 
 CG No CG13550  Old CG No CG13550 
 Synonyms CG13550 
 Accession No (Link to NCBI) NM_137942.1 
 Inserted Chr. ll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
[Please submit your publication]
Saj A, Arziman Z, Stempfle D, van Belle W, Sauder U, Horn T, D├╝rrenberger M, Paro R, Boutros M, Merdes G.
A combined ex vivo and in vivo RNAi screen for notch regulators in Drosophila reveals an extensive notch interaction network.
Dev. Cell (2010) 18(5) 862-76 [ PubMed ID = 20493818 ] [ RRC reference ]

Tiwari P, Kumar A, Das RN, Malhotra V, VijayRaghavan K.
A Tendon Cell Specific RNAi Screen Reveals Novel Candidates Essential for Muscle Tendon Interaction.
PLoS ONE (2015) 10(10) e0140976 [ PubMed ID = 26488612 ] [ RRC reference ]  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
 Primer Seq. 3'
 Predicted Fragment Size
 IR fragment full Seq
 in silico PCR Fragment
 Assemble Data

                           |||||| ||||||||||||||||||||||||||||| ||||||||||||||| ||||||| silico     1   CCCAGG-AGCAACCAAGATGTGTACGCCAAGCGAAGCCGGCTGGCCGAGCGA-ATAGCCC 60

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     61  AGAACGACGAGCTGATCCGCCAGGTGAAACAGCTGCAGGCTCAAAACAAACAGCTGGCCG 120

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     121 ACCTGCAGCGCACCGCCCAAGAGGTGACGGATCTGTACCAGAAGGAGAAGCAACAGAGGA 180

                           ||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| silico     181 TCGAGCTGGAGAAGCGCACCAAGCAGATCGGCGAGCGATGCGGACAGCTGGAAAAGGAGC 240

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     241 TGGACGTACAGGTTGGGAACTGCGAGAATCTGCAGGAGCAGCTGCAAGTGCGGGGACTAC 300

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     301 CCGTGGAAGCCAAGGATGTGCTGTCCATACTCATGCAGTTCTCCCAGCGGCTGGGCGACG 360

                           ||||||||||||||||||||||||||||||||||||||||||||||||||| | |||||| silico     361 ATTGTGGACTTTTGCGGCGGGATCAGAACATCATGAAGAAGCTAAGGGAGCACTGCAAGA 420

                           ||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| silico     421 CTATAGACGTAAGCGTGCCCACGCCAAAGAGCCCGAATTCACGTAGCAAACGGAAAGCCC 480

13550R-2.IR_full       481 ATCAGCCCGGAGTCAACCAATC 502
                           |||||||||||||||||||||| silico     481 ATCAGCCCGGAGTCAACCAATC 502

 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_137942.1  CG13550-RA (CG13550), mRNA 
0   NM_001032275.1  CG33949-RA (Rgk3), mRNA 
0   NM_078492.2  CG3312-RA, transcript variant A (Rnp4F), mRNA 
0   NM_206630.1  CG3312-RB, transcript variant B (Rnp4F), mRNA 
0   NM_139676.1  CG13708-RA (CG13708), mRNA 
0   NM_176097.1  CG33131-RA (SCAP), mRNA 
0   15  NM_141666.2  CG9492-RA (CG9492), mRNA 
0   NM_133113.1  CG7378-RA (CG7378), mRNA 
0   NM_137751.3  CG10082-RB, transcript variant B (CG10082), mRNA 
0   NM_166466.2  CG10082-RA, transcript variant A (CG10082), mRNA 
0   NM_140184.2  CG7628-RA (CG7628), mRNA 
0   13  NM_176734.1  CG33206-RA, transcript variant A (l(1)G0168), mRNA 
0   13  NM_176735.1  CG33206-RB, transcript variant B (l(1)G0168), mRNA 
0   NM_170385.1  CG1957-RB, transcript variant B (CG1957), mRNA 
0   NM_143401.1  CG1957-RA, transcript variant A (CG1957), mRNA 
0   NM_206610.1  CG14047-RB, transcript variant B (CG14047), mRNA 
0   NM_130645.2  CG14047-RA, transcript variant A (CG14047), mRNA 
0   NM_168947.1  CG7139-RB, transcript variant B (CG7139), mRNA 
0   NM_141121.2  CG7139-RA, transcript variant A (CG7139), mRNA 
0   NM_165255.1  CG10283-RB, transcript variant B (CG10283), mRNA 
0   NM_136035.4  CG10283-RA, transcript variant A (CG10283), mRNA 
0   NM_167443.1  CG9198-RB, transcript variant B (shtd), mRNA 
0   NM_132797.2  CG9198-RA, transcript variant A (shtd), mRNA 
0   NM_166682.1  CG3691-RA, transcript variant A (Pof), mRNA 
0   NM_079127.2  CG3691-RB, transcript variant B (Pof), mRNA 
0   NM_134816.2  CG31679-RA (CG31679), mRNA 
0   10  NM_132578.1  CG11146-RA (CG11146), mRNA 
0   12  NM_080157.2  CG11648-RB, transcript variant B (Abd-B), mRNA 
0   NM_080358.2  CG1484-RA (fliI), mRNA 
0   NM_079821.2  CG1954-RA (Pkc98E), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.