National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock discarded request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 13436R-3 
 Symbol CG13436  Full Name CG13436 
 CG No CG13436  Old CG No CG13436 
 Synonyms CG13436 
 Accession No (Link to NCBI) NM_137654.1 
 Inserted Chr. ll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees viable 
 Map Viewer
 Reference
[Please submit your publication]
 
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgTGAAGCGCTTCAAACAGTTGG 
 Primer Seq. 3'
aatctagaggtaccCCGATGGTACTTCTTCTTCAG 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 TGAAGCGCTT CAAACAGTTG GATCTCAGGG TCGACAAGGA GTTTGTCATC TACATGGTTC 
0061 ATTTGCTGGC AAGAGATCGG CGCAAAGGTC TCCTGAAGTA CGACCTCAAT AAGCCAACCG 
0121 CCTGTGCCAT TGAGGGTTTC GTGAATACAA TTGTGGATAG CTATGTCAAT TCGAAAGATT 
0181 GCACTATGGC CAACATGAAG ATGGCTTGGG TAATGAAAAA GGGAGTAACC ATAGACCTTG 
0241 AATACGTCAA GAAGAAGTAC GAGGAAAAGT TCCAAACCGA ACTGCAGCTG CTAATCAAGG 
0301 ATATCCTTCA GTATCCCGAG ACTTGCAGTA AAGTGCAGTT GGACCAGCTC TTCGCAAAGA 
0361 TGCAGGTCTT CATAGTGGCC TGCTACAGTC TGGGCTCGCC CAAGAATCAT GTTCTGCTTA 
0421 AGCTGACTgN CCAGGCTCTC AACAGCGTCA TCGGTCGAAG TGACCTACAG AATTATGTCC 
0481 TGAAGAAGAA GTACCATCGG  
 in silico PCR Fragment
0001 TGAAGCGCTT CAAACAGTTG GATCTCAGGG TCGACAAGGA GTTTGTCATC TACATGGTTC 
0061 ATTTGCTGGC AAGAGATCGG CGCAAAGGTC TCCTGAAGTA CGACCTCAAT AAGCCAACCG 
0121 CCTGTGCCAT TGAGGGTTTC GTGAATACAA TTGTGGATAG CTATGTCAAT TCGAAAGATT 
0181 GCACTATGGC CAACATGAAG ATGGCTTGGG TAATGAAAAA GGGAGTAACC ATAGACCTTG 
0241 AATACGTCAA GAAGAAGTAC GAGGAAAAGT TCCAAACCGA ACTGCAGCTG CTAATCAAGG 
0301 ATATCCTTCA GTATCCCGAG ACTTGCAGTA AAGTGCAGTT GGACCAGCTC TTCGCAAAGA 
0361 TGCAGGTCTT CATAGTGGCC TGCTACAGTC TGGGCTCGCC CAAGAATCAT GTTCTGCTTA 
0421 AGCTGACTGC CCAGGCTCTC AACAGCGTCA TCGGTCGAAG TGACCTACAG AATTATGTCC 
0481 TGAAGAAGAA GTACCATCGG  
 Assemble Data

13436R-3.IR_full       1   TGAAGCGCTTCAAACAGTTGGATCTCAGGGTCGACAAGGAGTTTGTCATCTACATGGTTC 60
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
13436R-3.in silico     1   TGAAGCGCTTCAAACAGTTGGATCTCAGGGTCGACAAGGAGTTTGTCATCTACATGGTTC 60


13436R-3.IR_full       61  ATTTGCTGGCAAGAGATCGGCGCAAAGGTCTCCTGAAGTACGACCTCAATAAGCCAACCG 120
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
13436R-3.in silico     61  ATTTGCTGGCAAGAGATCGGCGCAAAGGTCTCCTGAAGTACGACCTCAATAAGCCAACCG 120


13436R-3.IR_full       121 CCTGTGCCATTGAGGGTTTCGTGAATACAATTGTGGATAGCTATGTCAATTCGAAAGATT 180
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
13436R-3.in silico     121 CCTGTGCCATTGAGGGTTTCGTGAATACAATTGTGGATAGCTATGTCAATTCGAAAGATT 180


13436R-3.IR_full       181 GCACTATGGCCAACATGAAGATGGCTTGGGTAATGAAAAAGGGAGTAACCATAGACCTTG 240
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
13436R-3.in silico     181 GCACTATGGCCAACATGAAGATGGCTTGGGTAATGAAAAAGGGAGTAACCATAGACCTTG 240


13436R-3.IR_full       241 AATACGTCAAGAAGAAGTACGAGGAAAAGTTCCAAACCGAACTGCAGCTGCTAATCAAGG 300
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
13436R-3.in silico     241 AATACGTCAAGAAGAAGTACGAGGAAAAGTTCCAAACCGAACTGCAGCTGCTAATCAAGG 300


13436R-3.IR_full       301 ATATCCTTCAGTATCCCGAGACTTGCAGTAAAGTGCAGTTGGACCAGCTCTTCGCAAAGA 360
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
13436R-3.in silico     301 ATATCCTTCAGTATCCCGAGACTTGCAGTAAAGTGCAGTTGGACCAGCTCTTCGCAAAGA 360


13436R-3.IR_full       361 TGCAGGTCTTCATAGTGGCCTGCTACAGTCTGGGCTCGCCCAAGAATCATGTTCTGCTTA 420
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
13436R-3.in silico     361 TGCAGGTCTTCATAGTGGCCTGCTACAGTCTGGGCTCGCCCAAGAATCATGTTCTGCTTA 420


13436R-3.IR_full       421 AGCTGACTGNCCAGGCTCTCAACAGCGTCATCGGTCGAAGTGACCTACAGAATTATGTCC 480
                           ||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||
13436R-3.in silico     421 AGCTGACTGCCCAGGCTCTCAACAGCGTCATCGGTCGAAGTGACCTACAGAATTATGTCC 480


13436R-3.IR_full       481 TGAAGAAGAAGTACCATCGG 500
                           ||||||||||||||||||||
13436R-3.in silico     481 TGAAGAAGAAGTACCATCGG 500

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_137654.1  CG13436-RA (CG13436), mRNA 
0   NM_143335.1  CG5017-RA (CG5017), mRNA 
0   NM_079359.3  CG17962-RA (Z600), mRNA 
0   NM_079763.2  CG6868-RA (tld), mRNA 
0   NM_170629.2  CG32352-RC, transcript variant C (CG32352), mRNA 
0   NM_168279.2  CG32352-RA, transcript variant A (CG32352), mRNA 
0   NM_168278.1  CG32352-RB, transcript variant B (CG32352), mRNA 
0   NM_141456.2  CG10050-RA (CG10050), mRNA 
0   NM_137115.2  CG13939-RA (Obp50e), mRNA 
0   NM_079899.3  CG11186-RA (toy), mRNA 
0   NM_140926.1  CG13811-RA (CG13811), mRNA 
0   NM_137150.2  CG10209-RA (CG10209), mRNA 
0   NM_136448.2  CG2144-RA (CG2144), mRNA 
0   NM_079337.2  CG9206-RA (Gl), mRNA 
0   12  NM_135460.1  CG15828-RA, transcript variant A (CG15828), mRNA 
0   12  NM_205948.1  CG15828-RB, transcript variant B (CG15828), mRNA 
0   10  NM_078664.2  CG5870-RA (beta-Spec), mRNA 
0   NM_164985.1  CG6756-RB, transcript variant B (Tom70), mRNA 
0   NM_130499.1  CG13361-RA (CG13361), mRNA 
0   NM_135692.1  CG6756-RA, transcript variant A (Tom70), mRNA 
0   NM_164986.1  CG6756-RC, transcript variant C (Tom70), mRNA 
0   NM_169581.1  CG31320-RA (CG31320), mRNA 
0   NM_057643.2  CG10844-RA, transcript variant A (Rya-r44F), mRNA 
0   NM_057646.2  CG10844-RD, transcript variant D (Rya-r44F), mRNA 
0   NM_057645.2  CG10844-RC, transcript variant C (Rya-r44F), mRNA 
0   NM_057644.2  CG10844-RB, transcript variant B (Rya-r44F), mRNA 
0   NM_057268.3  CG6944-RA (Lam), mRNA 
0   NM_169838.1  CG14296-RA, transcript variant A (endoA), mRNA 
0   NM_138767.2  CG14296-RB, transcript variant B (endoA), mRNA 
0   NM_142059.2  CG9288-RA (CG9288), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.