National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock discarded request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 13410R-3 
 Symbol mRpL35  Full Name mitochondrial ribosomal protein L35 
 CG No CG13410  Old CG No CG13410 
 Synonyms MRP-L35, CG13410, BcDNA:RE35766, mRpL35 
 Accession No (Link to NCBI) NM_142744.1 
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
[Please submit your publication]
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
 Primer Seq. 3'
 Predicted Fragment Size
 IR fragment full Seq
0421 TT 
 in silico PCR Fragment
0421 TT 
 Assemble Data

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     1   ATGACTCTATCCCGTCCGTGCCTGTTGCCCACGCCATCACTGGCATCTCCTGCTCATCAC 60

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     61  CAGCTCCTGCAGCTGCCGGGTGTGCTAGCAGCCACAGGAACACCATCAAACACACGCAAC 120

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     121 GTGACCAAATTCTCGCTGGTGAAGGGTAAACGAAAGACCGTCAAGGCGGTACTGAAACGT 180

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     181 TTTAAGCGCCTGGACTGGGGCGCCTGGATACGCACCCATTCCGGTCGCCAAAAGAAGCTC 240

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     241 TTCAAGAAATCCGCAGCTTTACGACGCCGCCTCAAGCAGCACGTCTTCACCAATGCCACG 300

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     301 CAGAGCTGGCTGCTGGACAAGATGGTCACCAGCTATTGGCGGCGCCCAAAGCATTTCATC 360

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     361 AACGATCCCTATAAGCCCTATCACAGCCGCAACGAGTACTACGCCACACAGTCAAAGACC 420

13410R-3.IR_full       421 TT 422
                           || silico     421 TT 422

 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   404  NM_142744.1  CG13410-RA (mRpL35), mRNA 
0   NM_001038883.1  CG33988-RA (CG33988), mRNA 
0   NM_132272.1  CG11294-RA (CG11294), mRNA 
0   NM_132625.1  CG4351-RA (CG4351), mRNA 
0   NM_142646.1  CG5483-RA (CG5483), mRNA 
0   NM_165360.1  CG14396-RE, transcript variant E (Ret), mRNA 
0   NM_165359.1  CG14396-RC, transcript variant C (Ret), mRNA 
0   NM_057696.3  CG14396-RA, transcript variant A (Ret), mRNA 
0   NM_165358.1  CG14396-RB, transcript variant B (Ret), mRNA 
0   NM_057697.3  CG14396-RD, transcript variant D (Ret), mRNA 
0   NM_080014.2  CG3064-RB (futsch), mRNA 
0   NM_168311.1  CG32031-RA, transcript variant A (Argk), mRNA 
0   NM_168312.1  CG32031-RB, transcript variant B (Argk), mRNA 
0   NM_166546.2  CG30092-RD, transcript variant D (jbug), mRNA 
0   NM_057861.2  CG3425-RA (T3dh), mRNA 
0   NM_080172.2  CG1856-RC, transcript variant C (ttk), mRNA 
0   NM_170567.1  CG1856-RD, transcript variant D (ttk), mRNA 
0   NM_170568.1  CG1856-RF, transcript variant F (ttk), mRNA 
0   NM_137690.2  CG10543-RA, transcript variant A (CG10543), mRNA 
0   NM_078529.3  CG18009-RD, transcript variant D (Trf2), mRNA 
0   NM_206654.1  CG18009-RA, transcript variant A (Trf2), mRNA 
0   NM_170566.1  CG1856-RE, transcript variant E (ttk), mRNA 
0   NM_170564.1  CG1856-RA, transcript variant A (ttk), mRNA 
0   NM_170565.1  CG1856-RB, transcript variant B (ttk), mRNA 
0   NM_134527.1  CG15322-RA (CG15322), mRNA 
0   NM_167589.1  CG32495-RB, transcript variant B (CG32495), mRNA 
0   NM_167591.1  CG32495-RC, transcript variant C (CG32495), mRNA 
0   NM_176752.1  CG6835-RC, transcript variant C (GS), mRNA 
0   NM_176753.1  CG6835-RD, transcript variant D (GS), mRNA 
0   NM_167590.1  CG32495-RA, transcript variant A (CG32495), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.