National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 13410R-2 
 Symbol mRpL35  Full Name mitochondrial ribosomal protein L35 
 CG No CG13410  Old CG No CG13410 
 Synonyms MRP-L35, CG13410, BcDNA:RE35766, mRpL35 
 Accession No (Link to NCBI) NM_142744.1 
 Inserted Chr.
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
 Reference
[Please submit your publication]
 
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgATGACTCTATCCCGTCCGTGC 
 Primer Seq. 3'
aatctagaggtaccAAGGTCTTTGACTGTGTGGCG 
 Predicted Fragment Size
422 
 IR fragment full Seq
0001 ATGACTCTAT CCCGTCCGTG CCTGTTGCCC ACGCCATCAC TGGCATCTCC TGCTCATCAC 
0061 CAGCTCCTGC AGCTGCCGGG TGTGCTAGCA GCCACAGGAA CACCATCAAA CACACGCAAC 
0121 GTGACCAAAT TCTCGCTGGT GAAGGGTAAA CGAAAGACCG TCAAGGCGGT ACTGAAACGT 
0181 TTTAAGCGCC TGGACTGGGG CGCCTGGATA CGCACCCATT CCGGTCGCCA AAAGAAGCTC 
0241 TTCAAGAAAT CCGCAGCTTT ACGACGCCGC CTCAAGCAGC ACGTCTTCAC CAATGCCACG 
0301 CAGAGCTGGC TGCTGGACAA GATGGTCACC AGCTATTGGC GGCGCCCAAA GCATTTCATC 
0361 AACGATCCCT ATAAGCCCTA TCACAGCCGC AACGAGTACT ACGCCACACA GTCAAAGACC 
0421 TT 
 in silico PCR Fragment
0001 ATGACTCTAT CCCGTCCGTG CCTGTTGCCC ACGCCATCAC TGGCATCTCC TGCTCATCAC 
0061 CAGCTCCTGC AGCTGCCGGG TGTGCTAGCA GCCACAGGAA CACCATCAAA CACACGCAAC 
0121 GTGACCAAAT TCTCGCTGGT GAAGGGTAAA CGAAAGACCG TCAAGGCGGT ACTGAAACGT 
0181 TTTAAGCGCC TGGACTGGGG CGCCTGGATA CGCACCCATT CCGGTCGCCA AAAGAAGCTC 
0241 TTCAAGAAAT CCGCAGCTTT ACGACGCCGC CTCAAGCAGC ACGTCTTCAC CAATGCCACG 
0301 CAGAGCTGGC TGCTGGACAA GATGGTCACC AGCTATTGGC GGCGCCCAAA GCATTTCATC 
0361 AACGATCCCT ATAAGCCCTA TCACAGCCGC AACGAGTACT ACGCCACACA GTCAAAGACC 
0421 TT 
 Assemble Data

13410R-2.IR_full       1   ATGACTCTATCCCGTCCGTGCCTGTTGCCCACGCCATCACTGGCATCTCCTGCTCATCAC 60
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
13410R-2.in silico     1   ATGACTCTATCCCGTCCGTGCCTGTTGCCCACGCCATCACTGGCATCTCCTGCTCATCAC 60


13410R-2.IR_full       61  CAGCTCCTGCAGCTGCCGGGTGTGCTAGCAGCCACAGGAACACCATCAAACACACGCAAC 120
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
13410R-2.in silico     61  CAGCTCCTGCAGCTGCCGGGTGTGCTAGCAGCCACAGGAACACCATCAAACACACGCAAC 120


13410R-2.IR_full       121 GTGACCAAATTCTCGCTGGTGAAGGGTAAACGAAAGACCGTCAAGGCGGTACTGAAACGT 180
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
13410R-2.in silico     121 GTGACCAAATTCTCGCTGGTGAAGGGTAAACGAAAGACCGTCAAGGCGGTACTGAAACGT 180


13410R-2.IR_full       181 TTTAAGCGCCTGGACTGGGGCGCCTGGATACGCACCCATTCCGGTCGCCAAAAGAAGCTC 240
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
13410R-2.in silico     181 TTTAAGCGCCTGGACTGGGGCGCCTGGATACGCACCCATTCCGGTCGCCAAAAGAAGCTC 240


13410R-2.IR_full       241 TTCAAGAAATCCGCAGCTTTACGACGCCGCCTCAAGCAGCACGTCTTCACCAATGCCACG 300
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
13410R-2.in silico     241 TTCAAGAAATCCGCAGCTTTACGACGCCGCCTCAAGCAGCACGTCTTCACCAATGCCACG 300


13410R-2.IR_full       301 CAGAGCTGGCTGCTGGACAAGATGGTCACCAGCTATTGGCGGCGCCCAAAGCATTTCATC 360
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
13410R-2.in silico     301 CAGAGCTGGCTGCTGGACAAGATGGTCACCAGCTATTGGCGGCGCCCAAAGCATTTCATC 360


13410R-2.IR_full       361 AACGATCCCTATAAGCCCTATCACAGCCGCAACGAGTACTACGCCACACAGTCAAAGACC 420
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
13410R-2.in silico     361 AACGATCCCTATAAGCCCTATCACAGCCGCAACGAGTACTACGCCACACAGTCAAAGACC 420


13410R-2.IR_full       421 TT 422
                           ||
13410R-2.in silico     421 TT 422

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   404  NM_142744.1  CG13410-RA (mRpL35), mRNA 
0   NM_001038883.1  CG33988-RA (CG33988), mRNA 
0   NM_132272.1  CG11294-RA (CG11294), mRNA 
0   NM_132625.1  CG4351-RA (CG4351), mRNA 
0   NM_142646.1  CG5483-RA (CG5483), mRNA 
0   NM_165360.1  CG14396-RE, transcript variant E (Ret), mRNA 
0   NM_165359.1  CG14396-RC, transcript variant C (Ret), mRNA 
0   NM_057696.3  CG14396-RA, transcript variant A (Ret), mRNA 
0   NM_165358.1  CG14396-RB, transcript variant B (Ret), mRNA 
0   NM_057697.3  CG14396-RD, transcript variant D (Ret), mRNA 
0   NM_080014.2  CG3064-RB (futsch), mRNA 
0   NM_168311.1  CG32031-RA, transcript variant A (Argk), mRNA 
0   NM_168312.1  CG32031-RB, transcript variant B (Argk), mRNA 
0   NM_166546.2  CG30092-RD, transcript variant D (jbug), mRNA 
0   NM_057861.2  CG3425-RA (T3dh), mRNA 
0   NM_080172.2  CG1856-RC, transcript variant C (ttk), mRNA 
0   NM_170567.1  CG1856-RD, transcript variant D (ttk), mRNA 
0   NM_170568.1  CG1856-RF, transcript variant F (ttk), mRNA 
0   NM_137690.2  CG10543-RA, transcript variant A (CG10543), mRNA 
0   NM_078529.3  CG18009-RD, transcript variant D (Trf2), mRNA 
0   NM_206654.1  CG18009-RA, transcript variant A (Trf2), mRNA 
0   NM_170566.1  CG1856-RE, transcript variant E (ttk), mRNA 
0   NM_170564.1  CG1856-RA, transcript variant A (ttk), mRNA 
0   NM_170565.1  CG1856-RB, transcript variant B (ttk), mRNA 
0   NM_134527.1  CG15322-RA (CG15322), mRNA 
0   NM_167589.1  CG32495-RB, transcript variant B (CG32495), mRNA 
0   NM_167591.1  CG32495-RC, transcript variant C (CG32495), mRNA 
0   NM_176752.1  CG6835-RC, transcript variant C (GS), mRNA 
0   NM_176753.1  CG6835-RD, transcript variant D (GS), mRNA 
0   NM_167590.1  CG32495-RA, transcript variant A (CG32495), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.