National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock discarded request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 13379R-2 
 Symbol CG13379  Full Name CG13379 
 CG No CG13379  Old CG No CG13379 
 Synonyms CG13379 
 Accession No (Link to NCBI) NM_140793.1 
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees pupal semi-lethal 
 Map Viewer
[Please submit your publication]
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
 Primer Seq. 3'
 Predicted Fragment Size
 IR fragment full Seq
 in silico PCR Fragment
 Assemble Data

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     1   CAGCCAACATGCCGACGACAACAGGAGCTCAGGGATCGGGAAACCAAGTTCCCACAACTA 60

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     61  GCACTACGATTGTAAACCACTTCCGGGAGTTGATCAAGGAACCGAAGAACCTCGACGAGG 120

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     121 CGGCCAACTATCTGTACCAGTCGCTGCTCGACGACGCCGTAGTCGGAATCTTTAACGAGA 180

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     181 CACATCATCTGCGAAAGTCAGGGAATCTGGCCGCCCTGGACGGAGTGCCGGAGGACTCAA 240

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     241 CCTATCGAATGTGCGAGATGCCCAACCTGGACATATTCGGCATCTCAACGGCCAAAAAGC 300

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     301 CAATGGACTGCACCTGCCCCAACTGTGATCGCCTGGTGGCCGCCGCCCGCTTCGCCCCGC 360

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     361 ACCTGGAAAAGTGCATGGGCATGGGTCGTATCTCGTCGCGAATTGCCTCTCGTCGCTTGG 420

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     421 CCACCAAAGAGGGCGCCACATCCGCCCACCTGCACTCTTCGGGAAATACCGGAGGCACTG 480

13379R-2.IR_full       481 ATGATGAGGATGACGTGGAC 500
                           |||||||||||||||||||| silico     481 ATGATGAGGATGACGTGGAC 500

 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_140793.1  CG13379-RA (CG13379), mRNA 
0   NM_169826.1  CG31224-RA (CG31224), mRNA 
0   NM_138012.2  CG2980-RA (thoc5), mRNA 
0   NM_078831.1  CG5006-RA (Or33c), mRNA 
0   NM_165123.2  CG3938-RC, transcript variant C (CycE), mRNA 
0   NM_057611.4  CG3938-RA, transcript variant A (CycE), mRNA 
0   NM_165125.2  CG3938-RE, transcript variant E (CycE), mRNA 
0   NM_165124.2  CG3938-RD, transcript variant D (CycE), mRNA 
0   NM_057612.4  CG3938-RB, transcript variant B (CycE), mRNA 
0   NM_176735.1  CG33206-RB, transcript variant B (l(1)G0168), mRNA 
0   NM_176734.1  CG33206-RA, transcript variant A (l(1)G0168), mRNA 
0   NM_167647.2  CG12199-RB, transcript variant B (kek5), mRNA 
0   NM_133154.2  CG12199-RA, transcript variant A (kek5), mRNA 
0   NM_140401.1  CG10741-RB, transcript variant B (CG10741), mRNA 
0   NM_168555.1  CG10741-RA, transcript variant A (CG10741), mRNA 
0   NM_169806.1  CG31235-RA (CG31235), mRNA 
0   NM_168670.1  CG32158-RB, transcript variant B (CG32158), mRNA 
0   NM_140919.1  CG7385-RA (CG7385), mRNA 
0   NM_058154.3  CG10060-RA (G-ialpha65A), mRNA 
0   NM_057685.3  CG11527-RA (Tig), mRNA 
0   NM_142495.1  CG14299-RA, transcript variant A (CG14299), mRNA 
0   NM_164689.1  CG11567-RB, transcript variant B (Cpr), mRNA 
0   NM_141538.1  CG7352-RA (CG7352), mRNA 
0   NM_176184.2  CG18250-RC, transcript variant C (Dg), mRNA 
0   NM_136243.2  CG9257-RA (CG9257), mRNA 
0   NM_133049.1  CG5988-RA (upd2), mRNA 
0   10  NM_142975.2  CG5669-RA (CG5669), mRNA 
0   NM_057737.2  CG15804-RA, transcript variant A (Dhc62B), mRNA 
0   NM_206236.1  CG15804-RB, transcript variant B (Dhc62B), mRNA 
0   NM_142220.1  CG6045-RA (CG6045), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.