National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 13377R-1 
 Symbol CG13377  Full Name CG13377 
 CG No CG13377  Old CG No CG13377 
 Synonyms EG:BACR37P7.9, CG13377 
 Accession No (Link to NCBI) NM_130479.2 
 Inserted Chr. ll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees viable 
 Map Viewer
 Reference
[Please submit your publication]
 
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgTGACCATGCTGGTGTTGGGCT 
 Primer Seq. 3'
aatctagaggtaccGCCCAGGATGTTGGTTCTGAG 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 TGACCATGCT GGTGTTGGGC TTCCAGTTGC TTGCGCTTTT TTCGATCGCC GGCGCGCTGC 
0061 TTATCTACCT GATTTGTAAG GTGCGCGAGG ATAGCGCATC TGCCAATGCG GATAGTCATC 
0121 CCAGTCGGGT GGTCCTGATA ACCAGTGCGG ATACCGCATT GGGTCTTCAA TTGTGCACCC 
0181 ATTTGGCTAA CAAGGGTTAT CGGGTTTTTG CTGGAATGAA AGAGGCCCAA GATTCGCTAC 
0241 CCGCCAAACT TCTTTGCGGT TGGATGAAGA TCCGAGAGTA CAGTGAGGAA CCCATTGCAG 
0301 GCACAATTAT TCCGATGAGA TTGGATGTCA CCCGAGAGGA TGTGCTTCGC GAGGCCACCG 
0361 TTATTATAGG CGCTAATCTA AATGCAGATG AGCGCGGTAT TGCGGCCGTA ATTAACACTA 
0421 GTGGCAGTGT TTTCCGAGGC CAGGTTGAAT CGCAGAATGT CCAGCAGTGG GAACACATGC 
0481 TCAGAACCAA CATCCTGGGC  
 in silico PCR Fragment
0001 TGACCATGCT GGTGTTGGGC TTCCAGTTGC TTGCGCTTTT TTCGATCGCC GGCGCGCTGC 
0061 TTATCTACCT GATTTGTAAG GTGCGCGAGG ATAGCGCATC TGCCAATGCG GATAGTCATC 
0121 CCAGTCGGGT GGTCCTGATA ACCAGTGCGG ATACCGCATT GGGTCTTCAA TTGTGCACCC 
0181 ATTTGGCTAA CAAGGGTTAT CGGGTTTTTG CTGGAATGAA AGAGGCCCAA GATTCGCTAC 
0241 CCGCCAAACT TCTTTGCGGT TGGATGAAGA TCCGAGAGTA CAGTGAGGAA CCCATTGCAG 
0301 GCACAATTAT TCCGATGAGA TTGGATGTCA CCCGAGAGGA TGTGCTTCGC GAGGCCACCG 
0361 TTATTATAGG CGCTAATCTA AATGCAGATG AGCGCGGTAT TGCGGCCGTA ATTAACACTA 
0421 GTGGCAGTGT TTTCCGAGGC CAGGTTGAAT CGCAGAATGT CCAGCAGTGG GAACACATGC 
0481 TCAGAACCAA CATCCTGGGC  
 Assemble Data

13377R-1.IR_full       1   TGACCATGCTGGTGTTGGGCTTCCAGTTGCTTGCGCTTTTTTCGATCGCCGGCGCGCTGC 60
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
13377R-1.in silico     1   TGACCATGCTGGTGTTGGGCTTCCAGTTGCTTGCGCTTTTTTCGATCGCCGGCGCGCTGC 60


13377R-1.IR_full       61  TTATCTACCTGATTTGTAAGGTGCGCGAGGATAGCGCATCTGCCAATGCGGATAGTCATC 120
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
13377R-1.in silico     61  TTATCTACCTGATTTGTAAGGTGCGCGAGGATAGCGCATCTGCCAATGCGGATAGTCATC 120


13377R-1.IR_full       121 CCAGTCGGGTGGTCCTGATAACCAGTGCGGATACCGCATTGGGTCTTCAATTGTGCACCC 180
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
13377R-1.in silico     121 CCAGTCGGGTGGTCCTGATAACCAGTGCGGATACCGCATTGGGTCTTCAATTGTGCACCC 180


13377R-1.IR_full       181 ATTTGGCTAACAAGGGTTATCGGGTTTTTGCTGGAATGAAAGAGGCCCAAGATTCGCTAC 240
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
13377R-1.in silico     181 ATTTGGCTAACAAGGGTTATCGGGTTTTTGCTGGAATGAAAGAGGCCCAAGATTCGCTAC 240


13377R-1.IR_full       241 CCGCCAAACTTCTTTGCGGTTGGATGAAGATCCGAGAGTACAGTGAGGAACCCATTGCAG 300
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
13377R-1.in silico     241 CCGCCAAACTTCTTTGCGGTTGGATGAAGATCCGAGAGTACAGTGAGGAACCCATTGCAG 300


13377R-1.IR_full       301 GCACAATTATTCCGATGAGATTGGATGTCACCCGAGAGGATGTGCTTCGCGAGGCCACCG 360
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
13377R-1.in silico     301 GCACAATTATTCCGATGAGATTGGATGTCACCCGAGAGGATGTGCTTCGCGAGGCCACCG 360


13377R-1.IR_full       361 TTATTATAGGCGCTAATCTAAATGCAGATGAGCGCGGTATTGCGGCCGTAATTAACACTA 420
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
13377R-1.in silico     361 TTATTATAGGCGCTAATCTAAATGCAGATGAGCGCGGTATTGCGGCCGTAATTAACACTA 420


13377R-1.IR_full       421 GTGGCAGTGTTTTCCGAGGCCAGGTTGAATCGCAGAATGTCCAGCAGTGGGAACACATGC 480
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
13377R-1.in silico     421 GTGGCAGTGTTTTCCGAGGCCAGGTTGAATCGCAGAATGTCCAGCAGTGGGAACACATGC 480


13377R-1.IR_full       481 TCAGAACCAACATCCTGGGC 500
                           ||||||||||||||||||||
13377R-1.in silico     481 TCAGAACCAACATCCTGGGC 500

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_130479.2  CG13377-RA (CG13377), mRNA 
0   NM_057220.3  CG17610-RA (grk), mRNA 
0   NM_165158.1  CG4559-RC, transcript variant C (Idgf3), mRNA 
0   NM_057908.3  CG4559-RA, transcript variant A (Idgf3), mRNA 
0   NM_165157.1  CG4559-RB, transcript variant B (Idgf3), mRNA 
0   NM_134991.2  CG15438-RA (CG15438), mRNA 
0   NM_143553.1  CG9702-RA (CG9702), mRNA 
0   NM_143153.2  CG4719-RA (tankyrase), mRNA 
0   NM_135660.1  CG14928-RA (CG14928), mRNA 
0   NM_140058.2  CG3529-RB (CG3529), mRNA 
0   11  NM_079701.4  CG3671-RA, transcript variant A (Mvl), mRNA 
0   11  NM_169944.1  CG3671-RB, transcript variant B (Mvl), mRNA 
0   NM_080323.2  CG10798-RA (dm), mRNA 
0   10  NM_001031867.1  CG33950-RF, transcript variant F (trol), mRNA 
0   10  NM_001031862.1  CG33950-RC, transcript variant C (trol), mRNA 
0   10  NM_001031864.1  CG33950-RE, transcript variant E (trol), mRNA 
0   10  NM_001031866.1  CG33950-RA, transcript variant A (trol), mRNA 
0   10  NM_001031863.1  CG33950-RD, transcript variant D (trol), mRNA 
0   10  NM_001031865.1  CG33950-RB, transcript variant B (trol), mRNA 
0   NM_165979.1  CG32843-RA (CG32843), mRNA 
0   NM_136154.1  CG10631-RA (CG10631), mRNA 
0   NM_143743.1  CG11901-RA, transcript variant A (Ef1gamma), mRNA 
0   NM_170401.1  CG11901-RB, transcript variant B (Ef1gamma), mRNA 
0   NM_141614.1  CG16735-RA (CG16735), mRNA 
0   11  NM_057943.3  CG12249-RA, transcript variant A (mira), mRNA 
0   11  NM_057944.3  CG12249-RB, transcript variant B (mira), mRNA 
0   NM_057882.3  CG1609-RA (Gcn2), mRNA 
0   NM_141384.2  CG15188-RA (Osi20), mRNA 
0   NM_139417.2  CG12026-RA, transcript variant A (CG12026), mRNA 
0   NM_167926.2  CG12026-RB, transcript variant B (CG12026), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.