National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock discarded request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 13372R-3 
 Symbol CG18273  Full Name CG18273 
 CG No CG18273  Old CG No CG13372 
 Synonyms EG:171D11.6, CG13372, CG18273 
 Accession No (Link to NCBI) NM_130487.2 
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
[Please submit your publication]
Rauskolb C, Pan G, Reddy BV, Oh H, Irvine KD.
Zyxin links fat signaling to the hippo pathway.
PLoS Biol (2011) 9(6) e1000624 [ PubMed ID = 21666802 ] [ RRC reference ]  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
 Primer Seq. 3'
 Predicted Fragment Size
 IR fragment full Seq
 in silico PCR Fragment
 Assemble Data

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     1   TGGTTCTCAGTTCTGAGCTGCTCCAGGATGCCTTGCGGTCCAGCAACAAGCTTCTATTCG 60

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     61  AATGCTATGGCAGCCTGTTCAGATGCCATCAAAAGTGCGTCGAACTTCGCAAGGATAACA 120

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     121 AGGATCGGACTGAGAGCCAAGACCACTGGGATGCAGAGTTTGTAGTTCCTGTGATCAAGC 180

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     181 AGCTGACAGAGATGGTTCGCCGCTCTCAGGAGCCTGAAAAGCTTTTAGAAGAGTACAATT 240

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     241 CGAAAACTGTTCGTCCTCTTGTGGAGCTGCATCTGACCTTAAAAACTTCATGCCTAGACG 300

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     301 AACTGGCCGAGCTGGAAAAGCAAATCAAGGCGGAGTTTGACATCACACGGATTAAGGACC 360

                           |||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| silico     361 TTCCGCTGCATGTCAG-CCTGATCCTTTTGGAGGCTAGTGTCCTGAATAATCGCTTCCAA 420

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     421 ACAGCTAACATCAGCACCATCTTACTGTGTATATTTAACACGGAGGCATTATCGCAGTCA 480

13372R-3.IR_full       481 TCGCTTCAACTGACCGCCCAT 501
                           ||||||||||||||||||||| silico     481 TCGCTTCAACTGACCGCCCAT 501

 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_130487.2  CG18273-RA (CG18273), mRNA 
15.14   73  113  41  11  NM_166843.3  CG18166-RA, transcript variant A (CG18166), mRNA 
13.07   63  108  42  11  NM_176678.1  CG18166-RB, transcript variant B (CG18166), mRNA 
0   NM_134601.1  CG1718-RA (CG1718), mRNA 
0   NM_131956.1  CG15472-RA (CG15472), mRNA 
0   NM_139922.2  CG13676-RA (CG13676), mRNA 
0   NM_170551.1  CG11334-RA, transcript variant A (CG11334), mRNA 
0   NM_143611.2  CG11334-RB, transcript variant B (CG11334), mRNA 
0   NM_130554.2  CG11448-RA (CG11448), mRNA 
0   NM_170542.1  CG18729-RA (zwilch), mRNA 
0   NM_143108.1  CG11859-RA (CG11859), mRNA 
0   NM_132068.1  CG15899-RB (Ca-alpha1T), mRNA 
0   NM_080186.2  CG2830-RA (Hsp60B), mRNA 
0   NM_001032402.1  CG33957-RB, transcript variant B (cp309), mRNA 
0   NM_136006.2  CG15145-RA (CG15145), mRNA 
0   NM_001015119.1  CG40498-PA.3 (CG40498), mRNA 
0   NM_138220.1  CG13889-RA (CG13889), mRNA 
0   NM_136372.2  CG3274-RA (Bap170), mRNA 
0   NM_166427.2  CG9415-RB, transcript variant B (Xbp1), mRNA 
0   NM_079983.2  CG9415-RA, transcript variant A (Xbp1), mRNA 
0   NM_139489.1  CG9977-RA (CG9977), mRNA 
0   NM_078548.2  CG2985-RA (Yp1), mRNA 
0   NM_134517.2  CG15618-RA (CG15618), mRNA 
0   NM_139863.3  CG8560-RA (CG8560), mRNA 
0   NM_139907.2  CG8254-RA (exex), mRNA 
0   10  NM_057265.3  CG1264-RA (lab), mRNA 
0   NM_132871.2  CG8939-RA (CG8939), mRNA 
0   NM_168748.1  CG32186-RA (CG32186), mRNA 
0   NM_132144.2  CG3040-RA (CG3040), mRNA 
0   NM_143282.2  CG5880-RA (CG5880), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.