National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 13372R-1 
 Symbol CG18273  Full Name CG18273 
 CG No CG18273  Old CG No CG13372 
 Synonyms EG:171D11.6, CG13372, CG18273 
 Accession No (Link to NCBI) NM_130487.2 
 Inserted Chr. ll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
 Reference
[Please submit your publication]
Rauskolb C, Pan G, Reddy BV, Oh H, Irvine KD.
Zyxin links fat signaling to the hippo pathway.
PLoS Biol (2011) 9(6) e1000624 [ PubMed ID = 21666802 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgTGGTTCTCAGTTCTGAGCTGC 
 Primer Seq. 3'
aatctagaggtaccATGGGCGGTCAGTTGAAGCGA 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 TGGTTCTCAG TTCTGAGCTG CTCCAGGATG CCTTGCGGTC CAGCAACAAG CTTCTATTCG 
0061 AATGCTATGG CAGCCTGTTC AGATGCCATC AAAAGTGCGT CGAACTTCGC AAGGATAACA 
0121 AGGATCGGAC TGAGAGCCAA GACCACTGGG ATGCAGAGTT TGTAGTTCCT GTGATCAAGC 
0181 AGCTGACAGA GATGGTTCGC CGCTCTCAGG AGCCTGAAAA GCTTTTAGAA GAGTACAATT 
0241 CGAAAACTGT TCGTCCTCTT GTGGAGCTGC ATCTGACCTT AAAAACTTCA TGCCTAGACG 
0301 AACTGGCCGA GCTGGAAAAG CAAATCAAGG CGGAGTTTGA CATCACACGG ATTAAGGACC 
0361 TTCCGCTGCA TGTCAGCCCT GATCCTTTTG GAGGCTAGTG TCCTGAATAA TCGCTTCCAA 
0421 ACAGCTAACA TCAGCACCAT CTTACTGTGT ATATTTAACA CGGAGGCATT ATCGCAGTCA 
0481 TCGCTTCAAC TGACCGCCCA T 
 in silico PCR Fragment
0001 TGGTTCTCAG TTCTGAGCTG CTCCAGGATG CCTTGCGGTC CAGCAACAAG CTTCTATTCG 
0061 AATGCTATGG CAGCCTGTTC AGATGCCATC AAAAGTGCGT CGAACTTCGC AAGGATAACA 
0121 AGGATCGGAC TGAGAGCCAA GACCACTGGG ATGCAGAGTT TGTAGTTCCT GTGATCAAGC 
0181 AGCTGACAGA GATGGTTCGC CGCTCTCAGG AGCCTGAAAA GCTTTTAGAA GAGTACAATT 
0241 CGAAAACTGT TCGTCCTCTT GTGGAGCTGC ATCTGACCTT AAAAACTTCA TGCCTAGACG 
0301 AACTGGCCGA GCTGGAAAAG CAAATCAAGG CGGAGTTTGA CATCACACGG ATTAAGGACC 
0361 TTCCGCTGCA TGTCAG-CCT GATCCTTTTG GAGGCTAGTG TCCTGAATAA TCGCTTCCAA 
0421 ACAGCTAACA TCAGCACCAT CTTACTGTGT ATATTTAACA CGGAGGCATT ATCGCAGTCA 
0481 TCGCTTCAAC TGACCGCCCA T 
 Assemble Data

13372R-1.IR_full       1   TGGTTCTCAGTTCTGAGCTGCTCCAGGATGCCTTGCGGTCCAGCAACAAGCTTCTATTCG 60
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
13372R-1.in silico     1   TGGTTCTCAGTTCTGAGCTGCTCCAGGATGCCTTGCGGTCCAGCAACAAGCTTCTATTCG 60


13372R-1.IR_full       61  AATGCTATGGCAGCCTGTTCAGATGCCATCAAAAGTGCGTCGAACTTCGCAAGGATAACA 120
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
13372R-1.in silico     61  AATGCTATGGCAGCCTGTTCAGATGCCATCAAAAGTGCGTCGAACTTCGCAAGGATAACA 120


13372R-1.IR_full       121 AGGATCGGACTGAGAGCCAAGACCACTGGGATGCAGAGTTTGTAGTTCCTGTGATCAAGC 180
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
13372R-1.in silico     121 AGGATCGGACTGAGAGCCAAGACCACTGGGATGCAGAGTTTGTAGTTCCTGTGATCAAGC 180


13372R-1.IR_full       181 AGCTGACAGAGATGGTTCGCCGCTCTCAGGAGCCTGAAAAGCTTTTAGAAGAGTACAATT 240
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
13372R-1.in silico     181 AGCTGACAGAGATGGTTCGCCGCTCTCAGGAGCCTGAAAAGCTTTTAGAAGAGTACAATT 240


13372R-1.IR_full       241 CGAAAACTGTTCGTCCTCTTGTGGAGCTGCATCTGACCTTAAAAACTTCATGCCTAGACG 300
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
13372R-1.in silico     241 CGAAAACTGTTCGTCCTCTTGTGGAGCTGCATCTGACCTTAAAAACTTCATGCCTAGACG 300


13372R-1.IR_full       301 AACTGGCCGAGCTGGAAAAGCAAATCAAGGCGGAGTTTGACATCACACGGATTAAGGACC 360
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
13372R-1.in silico     301 AACTGGCCGAGCTGGAAAAGCAAATCAAGGCGGAGTTTGACATCACACGGATTAAGGACC 360


13372R-1.IR_full       361 TTCCGCTGCATGTCAGCCCTGATCCTTTTGGAGGCTAGTGTCCTGAATAATCGCTTCCAA 420
                           |||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||
13372R-1.in silico     361 TTCCGCTGCATGTCAG-CCTGATCCTTTTGGAGGCTAGTGTCCTGAATAATCGCTTCCAA 420


13372R-1.IR_full       421 ACAGCTAACATCAGCACCATCTTACTGTGTATATTTAACACGGAGGCATTATCGCAGTCA 480
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
13372R-1.in silico     421 ACAGCTAACATCAGCACCATCTTACTGTGTATATTTAACACGGAGGCATTATCGCAGTCA 480


13372R-1.IR_full       481 TCGCTTCAACTGACCGCCCAT 501
                           |||||||||||||||||||||
13372R-1.in silico     481 TCGCTTCAACTGACCGCCCAT 501

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_130487.2  CG18273-RA (CG18273), mRNA 
15.14   73  113  41  11  NM_166843.3  CG18166-RA, transcript variant A (CG18166), mRNA 
13.07   63  108  42  11  NM_176678.1  CG18166-RB, transcript variant B (CG18166), mRNA 
0   NM_134601.1  CG1718-RA (CG1718), mRNA 
0   NM_131956.1  CG15472-RA (CG15472), mRNA 
0   NM_139922.2  CG13676-RA (CG13676), mRNA 
0   NM_170551.1  CG11334-RA, transcript variant A (CG11334), mRNA 
0   NM_143611.2  CG11334-RB, transcript variant B (CG11334), mRNA 
0   NM_130554.2  CG11448-RA (CG11448), mRNA 
0   NM_170542.1  CG18729-RA (zwilch), mRNA 
0   NM_143108.1  CG11859-RA (CG11859), mRNA 
0   NM_132068.1  CG15899-RB (Ca-alpha1T), mRNA 
0   NM_080186.2  CG2830-RA (Hsp60B), mRNA 
0   NM_001032402.1  CG33957-RB, transcript variant B (cp309), mRNA 
0   NM_136006.2  CG15145-RA (CG15145), mRNA 
0   NM_001015119.1  CG40498-PA.3 (CG40498), mRNA 
0   NM_138220.1  CG13889-RA (CG13889), mRNA 
0   NM_136372.2  CG3274-RA (Bap170), mRNA 
0   NM_166427.2  CG9415-RB, transcript variant B (Xbp1), mRNA 
0   NM_079983.2  CG9415-RA, transcript variant A (Xbp1), mRNA 
0   NM_139489.1  CG9977-RA (CG9977), mRNA 
0   NM_078548.2  CG2985-RA (Yp1), mRNA 
0   NM_134517.2  CG15618-RA (CG15618), mRNA 
0   NM_139863.3  CG8560-RA (CG8560), mRNA 
0   NM_139907.2  CG8254-RA (exex), mRNA 
0   10  NM_057265.3  CG1264-RA (lab), mRNA 
0   NM_132871.2  CG8939-RA (CG8939), mRNA 
0   NM_168748.1  CG32186-RA (CG32186), mRNA 
0   NM_132144.2  CG3040-RA (CG3040), mRNA 
0   NM_143282.2  CG5880-RA (CG5880), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.