National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
Notification of resumption of orders:

Orders have been suspended as a response to the COVID-19 infection, but it will be resumed today, May 11. However, we would like to set our organizational framework that prioritizes the maintenance of stocks for the time being. In addition, due to delays in delivery of postal items, it is expected that the flies you ordered will not reach you in normal period. We apologize for the inconvenience.

Thank you for your understanding.

NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 13369R-2 
 Symbol CG13369  Full Name CG13369 
 CG No CG13369  Old CG No CG13369 
 Synonyms EG:115C2.1, CG13369 
 Accession No (Link to NCBI) NM_130494.2 
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
 Reference
[Please submit your publication]
Rauskolb C, Pan G, Reddy BV, Oh H, Irvine KD.
Zyxin links fat signaling to the hippo pathway.
PLoS Biol. (2011) 9(6) e1000624 [ PubMed ID = 21666802 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgGGCTCGGCCATCATTGACTTT 
 Primer Seq. 3'
aatctagaggtaccTGAAGAAGTTCGGGGGGTGTG 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 GGCTCNGGCC ATCATTGACT TTATAAGCTA CACGACCCGT CTACCGAAAG CCGGAGAAAC 
0061 GCTCCATGGG CATCGCTTTC AGATTGGCTA CGGCGGCAAG GGCGCCAATC AGTGTGTGGC 
0121 TGCCGCGCGC CAGGGATCCC GAACAGCTCT GGTGGCCAAA CTGGGGGCAG ACACATTCGG 
0181 CAGCGACTAC CTGAGACATC TGCGCGAGGA GCGCGTCNAA TGTAAACCAC GTCGAGCAGC 
0241 TGGCGGAGGA AACGACGGGC GTGGCCCAGA TAGCCGTGTC AGATGGCGGC GAGAACAACA 
0301 TCATCATTGT GGTGGGCGCC AACAATCGAC TGAGCTCGTG TGACGTTTCC TCGGCGAAGG 
0361 CGCTCTTCCA GGAAGCCAAA GTTCTGGTGT GCCAGCTGGA GACGCCCGTT GAGGCCACCC 
0421 TGACCGCTCT GAGAGCCTTC CGGGGCGTGT CCATCGTCAA TGCGGCTCCG GCCATGGCCG 
0481 ACACACCCCC CGAACTTCTT CA 
 in silico PCR Fragment
0001 GGCTC-GGCC ATCATTGACT TTATAAGCTA CACGACCCGT CTACCGAAAG CCGGAGAAAC 
0061 GCTCCATGGG CATCGCTTTC AGATTGGCTA CGGCGGCAAG GGCGCCAATC AGTGTGTGGC 
0121 TGCCGCGCGC CAGGGATCCC GAACAGCTCT GGTGGCCAAA CTGGGGGCAG ACACATTCGG 
0181 CAGCGACTAC CTGAGACATC TGCGCGAGGA GCGCGTC-AA TGTAAACCAC GTCGAGCAGC 
0241 TGGCGGAGGA AACGACGGGC GTGGCCCAGA TAGCCGTGTC AGATGGCGGC GAGAACAACA 
0301 TCATCATTGT GGTGGGCGCC AACAATCGAC TGAGCTCGTG TGACGTTTCC TCGGCGAAGG 
0361 CGCTCTTCCA GGAAGCCAAA GTTCTGGTGT GCCAGCTGGA GACGCCCGTT GAGGCCACCC 
0421 TGACCGCTCT GAGAGCCTTC CGGGGCGTGT CCATCGTCAA TGCGGCTCCG GCCATGGCCG 
0481 ACACACCCCC CGAACTTCTT CA 
 Assemble Data

13369R-2.IR_full       1   GGCTCNGGCCATCATTGACTTTATAAGCTACACGACCCGTCTACCGAAAGCCGGAGAAAC 60
                           ||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||
13369R-2.in silico     1   GGCTC-GGCCATCATTGACTTTATAAGCTACACGACCCGTCTACCGAAAGCCGGAGAAAC 60


13369R-2.IR_full       61  GCTCCATGGGCATCGCTTTCAGATTGGCTACGGCGGCAAGGGCGCCAATCAGTGTGTGGC 120
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
13369R-2.in silico     61  GCTCCATGGGCATCGCTTTCAGATTGGCTACGGCGGCAAGGGCGCCAATCAGTGTGTGGC 120


13369R-2.IR_full       121 TGCCGCGCGCCAGGGATCCCGAACAGCTCTGGTGGCCAAACTGGGGGCAGACACATTCGG 180
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
13369R-2.in silico     121 TGCCGCGCGCCAGGGATCCCGAACAGCTCTGGTGGCCAAACTGGGGGCAGACACATTCGG 180


13369R-2.IR_full       181 CAGCGACTACCTGAGACATCTGCGCGAGGAGCGCGTCNAATGTAAACCACGTCGAGCAGC 240
                           ||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||
13369R-2.in silico     181 CAGCGACTACCTGAGACATCTGCGCGAGGAGCGCGTC-AATGTAAACCACGTCGAGCAGC 240


13369R-2.IR_full       241 TGGCGGAGGAAACGACGGGCGTGGCCCAGATAGCCGTGTCAGATGGCGGCGAGAACAACA 300
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
13369R-2.in silico     241 TGGCGGAGGAAACGACGGGCGTGGCCCAGATAGCCGTGTCAGATGGCGGCGAGAACAACA 300


13369R-2.IR_full       301 TCATCATTGTGGTGGGCGCCAACAATCGACTGAGCTCGTGTGACGTTTCCTCGGCGAAGG 360
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
13369R-2.in silico     301 TCATCATTGTGGTGGGCGCCAACAATCGACTGAGCTCGTGTGACGTTTCCTCGGCGAAGG 360


13369R-2.IR_full       361 CGCTCTTCCAGGAAGCCAAAGTTCTGGTGTGCCAGCTGGAGACGCCCGTTGAGGCCACCC 420
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
13369R-2.in silico     361 CGCTCTTCCAGGAAGCCAAAGTTCTGGTGTGCCAGCTGGAGACGCCCGTTGAGGCCACCC 420


13369R-2.IR_full       421 TGACCGCTCTGAGAGCCTTCCGGGGCGTGTCCATCGTCAATGCGGCTCCGGCCATGGCCG 480
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
13369R-2.in silico     421 TGACCGCTCTGAGAGCCTTCCGGGGCGTGTCCATCGTCAATGCGGCTCCGGCCATGGCCG 480


13369R-2.IR_full       481 ACACACCCCCCGAACTTCTTCA 502
                           ||||||||||||||||||||||
13369R-2.in silico     481 ACACACCCCCCGAACTTCTTCA 502

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_130494.2  CG13369-RA (CG13369), mRNA 
0.2   NM_142312.1  CG14905-RA (CG14905), mRNA 
0   10  NM_135716.2  CG17010-RA, transcript variant A (CG17010), mRNA 
0   10  NM_165008.1  CG17010-RB, transcript variant B (CG17010), mRNA 
0   NM_140982.1  CG5059-RA, transcript variant A (CG5059), mRNA 
0   NM_206403.1  CG5059-RD, transcript variant D (CG5059), mRNA 
0   NM_168865.1  CG5059-RC, transcript variant C (CG5059), mRNA 
0   NM_168864.1  CG5059-RB, transcript variant B (CG5059), mRNA 
0   NM_079488.3  CG9054-RA (Ddx1), mRNA 
0   NM_134838.1  CG18641-RA (CG18641), mRNA 
0   NM_136485.2  CG30377-RA (CG30377), mRNA 
0   NM_143543.2  CG18030-RA (Jon99Fi), mRNA 
0   NM_143542.1  CG2229-RA (Jon99Fii), mRNA 
0   NM_168395.1  CG32054-RA (CG32054), mRNA 
0   NM_057552.2  CG1454-RA (wdn), mRNA 
0   NM_141154.2  CG14450-RA (CG14450), mRNA 
0   NM_078836.2  CG12403-RA (Vha68-1), mRNA 
0   NM_143368.1  CG9988-RA (CG9988), mRNA 
0   NM_132103.2  CG3973-RA (CG3973), mRNA 
0   NM_167408.1  CG32600-RA (dpr8), mRNA 
0   NM_078604.3  CG32592-RA (hiw), mRNA 
0   NM_140569.2  CG5841-RA (mib1), mRNA 
0   NM_166862.1  CG5273-RB, transcript variant B (CG5273), mRNA 
0   NM_166863.1  CG5273-RC, transcript variant C (CG5273), mRNA 
0   NM_130501.3  CG5273-RA, transcript variant A (CG5273), mRNA 
0   NM_140733.2  CG6322-RA (CG6322), mRNA 
0   NM_137993.2  CG4735-RA (shu), mRNA 
0   NM_136042.1  CG15160-RA (CG15160), mRNA 
0   NM_206412.1  CG10508-RF, transcript variant F (CG10508), mRNA 
0   NM_176384.2  CG10508-RC, transcript variant C (CG10508), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.