National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
Notice:

Suspension of shipments during Golden Week Holidays: From 30 April to 14 May, deadline 17 April.

NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 13345R-4 
 Symbol tum  Full Name tumbleweed 
 CG No CG13345  Old CG No CG13345 
 Synonyms tum, AcGAP, CG13345, racGAP50C, RacGap50C, 13345, i249, acGAP, RacGAP, eon, RhoGAP-50C14, DRacGAP, RacGAP50C 
 Accession No (Link to NCBI) NM_137068.2 
 Inserted Chr.
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees viable 
 Map Viewer
 Reference
[Please submit your publication]
Le Bras S, Rondanino C, Kriegel-Taki G, Dussert A, Le Borgne R.
Genetic identification of intracellular trafficking regulators involved in Notch-dependent binary cell fate acquisition following asymmetric cell division.
J Cell Sci (2012) 125(Pt 20) 4886-901 [ PubMed ID = 22825875 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgGACGGCCAGGATACAAAACGA 
 Primer Seq. 3'
aatctagaggtaccGCGATTTGCCAGTGGTTGGTG 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 NACGNCCAGG ATACAAAACG AGCTGGACAA GTCGTTGACC AAAATGGGCG ACCTGGAGGG 
0061 CAAACTCTTT CACGCACGCC GCATCATCGA CATGGAGATC AAGGCGCGCG CGCCAGGCGG 
0121 AACACGAACG AGATGCCATG GAGAGCAAGA TCATGGCTGT GGCAGATCTG CTGCGACACG 
0181 AGCGCAATCT GAACAACGAG ACCCGCGACA AGCTGGCCTT TCTGCACACA CTGCCCTCGT 
0241 CGCGAAAGCG CAAGTCCCTG AATGCCGTGC GGGAGGACAA GTCCTATGGC GACATCAACT 
0301 CCACCGGATC GTTGCTGTCG GATTTGTCTA TTACACACTC CGAGGACGAC TTCCTCGATG 
0361 TGCGCACATC AAAATCTTGG CGAGAGCATC GTCCTTCGCT GCCCAAGAAC CAGATTCCTA 
0421 GCGTTGGCAA CAAGAGATCG CGATTGAGCA CTGGACTGAA TGGCAGTATG TCCGGGACTA 
0481 CACCAACCAC TGGCAANANN Gc 
 in silico PCR Fragment
0001 GACGGCCAGG ATACAAAACG AGCTGGACAA GTCGTTGACC AAAATGGGCG ACCTGGAGGG 
0061 CAAACTCTTT CACGCACGCC GCATCATCGA CATGGAGATC AAGGCGCGC- CGCCAGGCGG 
0121 AACACGAACG AGATGCCATG GAGAGCAAGA TCATGGCTGT GGCAGATCTG CTGCGACACG 
0181 AGCGCAATCT GAACAACGAG ACCCGCGACA AGCTGGCCTT TCTGCACACA CTGCCCTCGT 
0241 CGCGAAAGCG CAAGTCCCTG AATGCCGTGC GGGAGGACAA GTCCTATGGC GACATCAACT 
0301 CCACCGGATC GTTGCTGTCG GATTTGTCTA TTACACACTC CGAGGACGAC TTCCTCGATG 
0361 TGCGCACATC AAAATCTTGG CGAGAGCATC GTCCTTCGCT GCCCAAGAAC CAGATTCCTA 
0421 GCGTTGGCAA CAAGAGATCG CGATTGAGCA CTGGACTGAA TGGCAGTATG TCCGGGACTA 
0481 CACCAACCAC TGGCAA-ATC GC 
 Assemble Data

13345R-4.IR_full        1   ACGNCCAGGATACAAAACGAGCTGGACAAGTCGTTGACCAAAATGGGCGACCTGGAGGG 59
                            ||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||
13345R-4.in silico      1   ACGGCCAGGATACAAAACGAGCTGGACAAGTCGTTGACCAAAATGGGCGACCTGGAGGG 59


13345R-4.IR_full       61  CAAACTCTTTCACGCACGCCGCATCATCGACATGGAGATCAAGGCGCGCGCGCCAGGCGG 119
                           ||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||
13345R-4.in silico     61  CAAACTCTTTCACGCACGCCGCATCATCGACATGGAGATCAAGGCGCGC-CGCCAGGCGG 119


13345R-4.IR_full       121 AACACGAACGAGATGCCATGGAGAGCAAGATCATGGCTGTGGCAGATCTGCTGCGACACG 179
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
13345R-4.in silico     121 AACACGAACGAGATGCCATGGAGAGCAAGATCATGGCTGTGGCAGATCTGCTGCGACACG 179


13345R-4.IR_full       181 AGCGCAATCTGAACAACGAGACCCGCGACAAGCTGGCCTTTCTGCACACACTGCCCTCGT 239
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
13345R-4.in silico     181 AGCGCAATCTGAACAACGAGACCCGCGACAAGCTGGCCTTTCTGCACACACTGCCCTCGT 239


13345R-4.IR_full       241 CGCGAAAGCGCAAGTCCCTGAATGCCGTGCGGGAGGACAAGTCCTATGGCGACATCAACT 299
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
13345R-4.in silico     241 CGCGAAAGCGCAAGTCCCTGAATGCCGTGCGGGAGGACAAGTCCTATGGCGACATCAACT 299


13345R-4.IR_full       301 CCACCGGATCGTTGCTGTCGGATTTGTCTATTACACACTCCGAGGACGACTTCCTCGATG 359
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
13345R-4.in silico     301 CCACCGGATCGTTGCTGTCGGATTTGTCTATTACACACTCCGAGGACGACTTCCTCGATG 359


13345R-4.IR_full       361 TGCGCACATCAAAATCTTGGCGAGAGCATCGTCCTTCGCTGCCCAAGAACCAGATTCCTA 419
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
13345R-4.in silico     361 TGCGCACATCAAAATCTTGGCGAGAGCATCGTCCTTCGCTGCCCAAGAACCAGATTCCTA 419


13345R-4.IR_full       421 GCGTTGGCAACAAGAGATCGCGATTGAGCACTGGACTGAATGGCAGTATGTCCGGGACTA 479
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
13345R-4.in silico     421 GCGTTGGCAACAAGAGATCGCGATTGAGCACTGGACTGAATGGCAGTATGTCCGGGACTA 479


13345R-4.IR_full       481 CACCAACCACTGGCAANANNGC 501
                           |||||||||||||||| |  ||
13345R-4.in silico     481 CACCAACCACTGGCAA-ATCGC 501

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_137068.2  CG13345-RA (RacGAP50C), mRNA 
0   NM_139656.1  CG13720-RA (CG13720), mRNA 
0   NM_165031.1  CG31728-RA (CG31728), mRNA 
0   14  NM_079009.2  CG18076-RA, transcript variant A (shot), mRNA 
0   14  NM_166017.1  CG18076-RE, transcript variant E (shot), mRNA 
0   NM_167090.1  CG14438-RB, transcript variant B (CG14438), mRNA 
0   NM_132120.1  CG14438-RA, transcript variant A (CG14438), mRNA 
0   15  NM_166016.1  CG18076-RB, transcript variant B (shot), mRNA 
0   15  NM_166015.1  CG18076-RG, transcript variant G (shot), mRNA 
0   NM_166018.1  CG18076-RC, transcript variant C (shot), mRNA 
0   NM_166019.1  CG18076-RH, transcript variant H (shot), mRNA 
0   NM_138143.1  CG12851-RA (CG12851), mRNA 
0   NM_139448.2  CG32300-RB (oxt), mRNA 
0   NM_137622.2  CG11788-RA (CG11788), mRNA 
0   NM_206635.2  CG3869-RB, transcript variant B (Marf), mRNA 
0   NM_132092.2  CG3869-RA, transcript variant A (Marf), mRNA 
0   NM_206634.1  CG3869-RC, transcript variant C (Marf), mRNA 
0   NM_132924.2  CG4678-RA, transcript variant A (CG4678), mRNA 
0   NM_001038761.1  CG4678-RC, transcript variant C (CG4678), mRNA 
0   NM_167536.2  CG4678-RB, transcript variant B (CG4678), mRNA 
0   NM_132751.1  CG9518-RA (CG9518), mRNA 
0   NM_139504.2  CG1893-RA (CG1893), mRNA 
0   NM_176716.2  CG7766-RB, transcript variant B (CG7766), mRNA 
0   NM_132297.4  CG7766-RA, transcript variant A (CG7766), mRNA 
0   NM_137344.2  CG30456-RA (CG30456), mRNA 
0   NM_164503.1  CG16987-RB, transcript variant B (Alp23B), mRNA 
0   NM_078737.2  CG16987-RA, transcript variant A (Alp23B), mRNA 
0   NM_141666.2  CG9492-RA (CG9492), mRNA 
0   NM_166417.1  CG30291-RA (CG30291), mRNA 
0   NM_080001.2  CG5354-RA (pie), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.