National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
Notice:

Suspension of shipments during Golden Week Holidays: From 30 April to 14 May, deadline 17 April.

NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 13344R-2 
 Symbol CG13344  Full Name CG13344 
 CG No CG13344  Old CG No CG13344 
 Synonyms anon-EST:GressD1, anon-EST:GreesD1, CG13344 
 Accession No (Link to NCBI) NM_137071.3 
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees viable 
 Map Viewer
 Reference
[Please submit your publication]
Ohhara Y, Hoshino G, Imahori K, Matsuyuki T, Yamakawa-Kobayashi K.
The Nutrient-Responsive Molecular Chaperone Hsp90 Supports Growth and Development in Drosophila.
Front Physiol (2021) 12 690564 [ PubMed ID = 34239451 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgGCAGATCGAGACCACGGTGCT 
 Primer Seq. 3'
aatctagaggtaccTGAGGCTATCCGTTTCGTCGC 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 GCAGATCGAG ACCACGGTGC TGCCCCCGAC CGGTGAGGNA GGAGGAGCAG CAGTACGTGT 
0061 GCGTTACCCT GCAGGTGCAT CCAACACCTG GCTATCCGGA GGAGAGCCCC ACATTCAAGC 
0121 TGCTGCGTCC GCGTGGATTG GACGATGCCC GCCTGGAGGC AATCCGAAGC GCGTGCAACG 
0181 CCAAGATCAA GGAGTCAATT GGTTTTCCGG TCGTTTTCGA CCTCATCGAG GTGGTGCGAG 
0241 AGCATCNTCA GTGGCAGCAA TCTGCCCAGT GGCCAGTGCG TTGTCTGTTT GTATGGATTC 
0301 GCTGATGGCG ACGAGTTCAC ACGCACCGAG TGCTTCCACT ACCTGCACAG CTATTGCCTG 
0361 GCTCGGCATC TCAATGCCCT ACGTCGCAAC TACCAGGAGG AGTTCGATAA ATTGCCTGCC 
0421 TGGCTGCAGA AGACGGCCGA TCCCTTCCAG GCGCTGTGCC CCGTTTGCCG TGAGCACATC 
0481 GGCGACGAAA CGGATAGCCT CA 
 in silico PCR Fragment
0001 GCAGATCGAG ACCACGGTGC TGCCCCTGAC CGGTGAGG-A GGAGGAGCAG CAGTACGTGT 
0061 GCGTTACCCT GCAGGTGCAT CCAACACCTG GCTATCCGGA GGAGAGCCCC ACATTCAAGC 
0121 TGCTGCGTCC GCGTGGATTG GACGATGCCC GCCTGGAGGC AATCCGAAGC GCGTGCAACG 
0181 CCAAGATCAA GGAGTCAATT GGTTTTCCGG TCGTTTTCGA CCTCATCGAG GTGGTGCGAG 
0241 AGCATC-TCA GTGGCAGCAA TCTGCCCAGT GGCCAGTGCG TTGTCTGTTT GTATGGATTC 
0301 GCTGATGGCG ACGAGTTCAC ACGCACCGAG TGCTTCCACT ACCTGCACAG CTATTGCCTG 
0361 GCTCGGCATC TCAATGCCCT ACGTCGCAAC TACCAGGAGG AGTTCGATAA ATTGCCTGCC 
0421 TGGCTGCAGA AGACGGCCGA TCCCTTCCAG GCGCTGTGCC CCGTTTGCCG TGAGCACATC 
0481 GGCGACGAAA CGGATAGCCT CA 
 Assemble Data

13344R-2.IR_full       1   GCAGATCGAGACCACGGTGCTGCCCCCGACCGGTGAGGNAGGAGGAGCAGCAGTACGTGT 60
                           |||||||||||||||||||||||||| ||||||||||| |||||||||||||||||||||
13344R-2.in silico     1   GCAGATCGAGACCACGGTGCTGCCCCTGACCGGTGAGG-AGGAGGAGCAGCAGTACGTGT 60


13344R-2.IR_full       61  GCGTTACCCTGCAGGTGCATCCAACACCTGGCTATCCGGAGGAGAGCCCCACATTCAAGC 120
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
13344R-2.in silico     61  GCGTTACCCTGCAGGTGCATCCAACACCTGGCTATCCGGAGGAGAGCCCCACATTCAAGC 120


13344R-2.IR_full       121 TGCTGCGTCCGCGTGGATTGGACGATGCCCGCCTGGAGGCAATCCGAAGCGCGTGCAACG 180
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
13344R-2.in silico     121 TGCTGCGTCCGCGTGGATTGGACGATGCCCGCCTGGAGGCAATCCGAAGCGCGTGCAACG 180


13344R-2.IR_full       181 CCAAGATCAAGGAGTCAATTGGTTTTCCGGTCGTTTTCGACCTCATCGAGGTGGTGCGAG 240
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
13344R-2.in silico     181 CCAAGATCAAGGAGTCAATTGGTTTTCCGGTCGTTTTCGACCTCATCGAGGTGGTGCGAG 240


13344R-2.IR_full       241 AGCATCNTCAGTGGCAGCAATCTGCCCAGTGGCCAGTGCGTTGTCTGTTTGTATGGATTC 300
                           |||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||
13344R-2.in silico     241 AGCATC-TCAGTGGCAGCAATCTGCCCAGTGGCCAGTGCGTTGTCTGTTTGTATGGATTC 300


13344R-2.IR_full       301 GCTGATGGCGACGAGTTCACACGCACCGAGTGCTTCCACTACCTGCACAGCTATTGCCTG 360
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
13344R-2.in silico     301 GCTGATGGCGACGAGTTCACACGCACCGAGTGCTTCCACTACCTGCACAGCTATTGCCTG 360


13344R-2.IR_full       361 GCTCGGCATCTCAATGCCCTACGTCGCAACTACCAGGAGGAGTTCGATAAATTGCCTGCC 420
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
13344R-2.in silico     361 GCTCGGCATCTCAATGCCCTACGTCGCAACTACCAGGAGGAGTTCGATAAATTGCCTGCC 420


13344R-2.IR_full       421 TGGCTGCAGAAGACGGCCGATCCCTTCCAGGCGCTGTGCCCCGTTTGCCGTGAGCACATC 480
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
13344R-2.in silico     421 TGGCTGCAGAAGACGGCCGATCCCTTCCAGGCGCTGTGCCCCGTTTGCCGTGAGCACATC 480


13344R-2.IR_full       481 GGCGACGAAACGGATAGCCTCA 502
                           ||||||||||||||||||||||
13344R-2.in silico     481 GGCGACGAAACGGATAGCCTCA 502

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_137071.3  CG13344-RA, transcript variant A (CG13344), mRNA 
100   482  NM_001032245.1  CG13344-RB, transcript variant B (CG13344), mRNA 
0.2   20  NM_143344.2  CG5520-RA (Gp93), mRNA 
0.2   NM_139742.1  CG13288-RA (CG13288), mRNA 
0   NM_136147.2  CG10364-RA (msb1l), mRNA 
0   11  20  NM_141658.3  CG8301-RA (CG8301), mRNA 
0   13  NM_140587.1  CG5151-RA, transcript variant A (CG5151), mRNA 
0   13  NM_206382.1  CG5151-RB, transcript variant B (CG5151), mRNA 
0   10  NM_079235.2  CG8571-RA, transcript variant A (smid), mRNA 
0   10  NM_206287.1  CG8571-RB, transcript variant B (smid), mRNA 
0   10  NM_057405.2  CG4244-RB, transcript variant B (Su(dx)), mRNA 
0   10  NM_164448.1  CG4244-RA, transcript variant A (Su(dx)), mRNA 
0   10  NM_164449.1  CG4244-RC, transcript variant C (Su(dx)), mRNA 
0   13  NM_079469.2  CG10573-RA (ko), mRNA 
0   NM_168881.1  CG32434-RB, transcript variant B (siz), mRNA 
0   NM_140277.1  CG17824-RA (CG17824), mRNA 
0   NM_140562.1  CG10516-RA (CG10516), mRNA 
0   14  NM_132512.2  CG2448-RA (FucT6), mRNA 
0   NM_138179.2  CG12313-RA (CG12313), mRNA 
0   NM_080259.1  CG14066-RA, transcript variant A (larp), mRNA 
0   NM_170366.1  CG14066-RB, transcript variant B (larp), mRNA 
0   NM_170365.1  CG14066-RC, transcript variant C (larp), mRNA 
0   NM_079107.2  CG11173-RA (usnp), mRNA 
0   NM_140723.1  CG12229-RA (CG12229), mRNA 
0   NM_164688.1  CG31640-RA (CG31640), mRNA 
0   NM_001014670.2  CG5462-RH, transcript variant H (scrib), mRNA 
0   NM_170277.1  CG5462-RC, transcript variant C (scrib), mRNA 
0   NM_001014669.1  CG5462-RI, transcript variant I (scrib), mRNA 
0   NM_170275.1  CG5462-RA, transcript variant A (scrib), mRNA 
0   NM_001043296.1  CG5462-RG, transcript variant G (scrib), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.