National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
Notice:

Suspension of shipments during Golden Week Holidays: From 30 April to 14 May, deadline 17 April.

NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock discarded request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 13343R-3 
 Symbol CG13343  Full Name CG13343 
 CG No CG13343  Old CG No CG13343 
 Synonyms CG13343 
 Accession No (Link to NCBI) NM_137069.2 
 Inserted Chr. ll 
 Insertional Mutation  3 lethal 
 Phenotype induced by Act5C-GAL4 at 28 degrees male lethal, female semi-lethal 
 Map Viewer
 Reference
[Please submit your publication]
 
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgTCCACTCACCCAATCCTGGCT 
 Primer Seq. 3'
aatctagaggtaccGGTGCCGTCCTCCTCATATCG 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 TCCACTCACC CAATCCTGGC TTAATCCTCC AGAGCAAGCG TTTCAATGGA CTGCGGAACA 
0061 TCCTGGAACG CGAAGGTCCC TTCTGCAAGG ACGGTTTCGC GGCCTCGTCG GAAAACCTGG 
0121 AGTTCTTGCA GACCAAGTGC CAGGTTCTGA TCATCGGAGC CGGCGGCCTG GGCTGCGAAC 
0181 TGCTGAAGGA TCTGGCTCTG ATGGGCTTCG GCAACCTGCA CGTCATCGAC ATGGACACCA 
0241 TCGAGCTGTC CAACCTGAAT CGCCAGTTTC TGTTCCGTCG CACCGACATT GGCGCCTCCA 
0301 AGGCGGAGTG TGCGGCTCGC TTCATCAACG CAAGAGTGCC TACTTGCCGG GTGACGCCGC 
0361 ATTTCAAGAA GATCCAGGAC TTCGATGAGT CCTTTTATCA GCAGTTCCAC CTGGTTGNCT 
0421 GTGGCCTAGA CTCCATTGTC GCCCGGCGTT GGATCAATGG NATGCTGCTC TCCATGCTGC 
0481 GATATGAGGA GGACGGCACC  
 in silico PCR Fragment
0001 TCCACTCACC CAATCCTGGC TTAATCCTCC AGAGCAAGCG TTTCAATGGA CTGCGGAACA 
0061 TCCTGGAACG CGAAGGTCCC TTCTGCAAGG ACGGTTTCGC GGCCTCGTCG GAAAACCTGG 
0121 AGTTCTTGCA GACCAAGTGC CAGGTTCTGA TCATCGGAGC CGGTGGCCTG GGCTGCGAAC 
0181 TGCTGAAGGA TCTGGCTCTG ATGGGCTTCG GCAACCTGCA CGTCATCGAC ATGGACACCA 
0241 TCGAGCTGTC CAACCTGAAT CGCCAGTTTC TGTTCCGTCG CACAGACATT GGCGCCTCCA 
0301 AGGCGGAGTG TGCGGCTCGC TTCATCAACG CAAGAGTGCC TACTTGCCGG GTGACGCCGC 
0361 ATTTCAAGAA AATCCAGGAC TTCGATGAGT CCTTCTATCA GCAGTTCCAC CTGGTTGTCT 
0421 GTGGCCTAGA CTCCATTGTC GCCCGGCGTT GGATCAATGG CATGCTGCTA TCAATGCTGC 
0481 GATATGAGGA GGACGGCACC  
 Assemble Data

13343R-3.IR_full       1   TCCACTCACCCAATCCTGGCTTAATCCTCCAGAGCAAGCGTTTCAATGGACTGCGGAACA 60
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
13343R-3.in silico     1   TCCACTCACCCAATCCTGGCTTAATCCTCCAGAGCAAGCGTTTCAATGGACTGCGGAACA 60


13343R-3.IR_full       61  TCCTGGAACGCGAAGGTCCCTTCTGCAAGGACGGTTTCGCGGCCTCGTCGGAAAACCTGG 120
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
13343R-3.in silico     61  TCCTGGAACGCGAAGGTCCCTTCTGCAAGGACGGTTTCGCGGCCTCGTCGGAAAACCTGG 120


13343R-3.IR_full       121 AGTTCTTGCAGACCAAGTGCCAGGTTCTGATCATCGGAGCCGGCGGCCTGGGCTGCGAAC 180
                           ||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||
13343R-3.in silico     121 AGTTCTTGCAGACCAAGTGCCAGGTTCTGATCATCGGAGCCGGTGGCCTGGGCTGCGAAC 180


13343R-3.IR_full       181 TGCTGAAGGATCTGGCTCTGATGGGCTTCGGCAACCTGCACGTCATCGACATGGACACCA 240
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
13343R-3.in silico     181 TGCTGAAGGATCTGGCTCTGATGGGCTTCGGCAACCTGCACGTCATCGACATGGACACCA 240


13343R-3.IR_full       241 TCGAGCTGTCCAACCTGAATCGCCAGTTTCTGTTCCGTCGCACCGACATTGGCGCCTCCA 300
                           ||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||
13343R-3.in silico     241 TCGAGCTGTCCAACCTGAATCGCCAGTTTCTGTTCCGTCGCACAGACATTGGCGCCTCCA 300


13343R-3.IR_full       301 AGGCGGAGTGTGCGGCTCGCTTCATCAACGCAAGAGTGCCTACTTGCCGGGTGACGCCGC 360
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
13343R-3.in silico     301 AGGCGGAGTGTGCGGCTCGCTTCATCAACGCAAGAGTGCCTACTTGCCGGGTGACGCCGC 360


13343R-3.IR_full       361 ATTTCAAGAAGATCCAGGACTTCGATGAGTCCTTTTATCAGCAGTTCCACCTGGTTGNCT 420
                           |||||||||| ||||||||||||||||||||||| |||||||||||||||||||||| ||
13343R-3.in silico     361 ATTTCAAGAAAATCCAGGACTTCGATGAGTCCTTCTATCAGCAGTTCCACCTGGTTGTCT 420


13343R-3.IR_full       421 GTGGCCTAGACTCCATTGTCGCCCGGCGTTGGATCAATGGNATGCTGCTCTCCATGCTGC 480
                           |||||||||||||||||||||||||||||||||||||||| |||||||| || |||||||
13343R-3.in silico     421 GTGGCCTAGACTCCATTGTCGCCCGGCGTTGGATCAATGGCATGCTGCTATCAATGCTGC 480


13343R-3.IR_full       481 GATATGAGGAGGACGGCACC 500
                           ||||||||||||||||||||
13343R-3.in silico     481 GATATGAGGAGGACGGCACC 500

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_137069.2  CG13343-RA (CG13343), mRNA 
0.2   NM_205912.1  CG11020-RB, transcript variant B (nompC), mRNA 
0.2   NM_078759.2  CG11020-RA, transcript variant A (nompC), mRNA 
0   NM_169912.1  CG4058-RB, transcript variant B (Nep4), mRNA 
0   NM_142647.2  CG4058-RA, transcript variant A (Nep4), mRNA 
0   NM_166291.1  CG30116-RD, transcript variant D (CG30116), mRNA 
0   NM_166292.1  CG30116-RA, transcript variant A (CG30116), mRNA 
0   NM_137494.1  CG30116-RB, transcript variant B (CG30116), mRNA 
0   NM_137493.2  CG30116-RC, transcript variant C (CG30116), mRNA 
0   NM_168383.1  CG6718-RB, transcript variant B (CG6718), mRNA 
0   NM_168385.1  CG6718-RD, transcript variant D (CG6718), mRNA 
0   NM_140109.1  CG6718-RA, transcript variant A (CG6718), mRNA 
0   NM_168384.1  CG6718-RC, transcript variant C (CG6718), mRNA 
0   NM_136864.2  CG13185-RA (CG13185), mRNA 
0   NM_078982.2  CG8344-RA (RpIII128), mRNA 
0   NM_141666.2  CG9492-RA (CG9492), mRNA 
0   NM_206045.1  CG3572-RC, transcript variant C (vimar), mRNA 
0   NM_057957.4  CG3572-RB, transcript variant B (vimar), mRNA 
0   NM_057837.3  CG1616-RA (dpa), mRNA 
0   NM_133114.2  CG32541-RA (CG32541), mRNA 
0   NM_080536.2  CG4013-RA, transcript variant A (Smr), mRNA 
0   NM_167334.1  CG4013-RB, transcript variant B (Smr), mRNA 
0   NM_167335.1  CG4013-RC, transcript variant C (Smr), mRNA 
0   NM_165148.1  CG31819-RA (CG31819), mRNA 
0   NM_057784.4  CG7833-RA (Orc5), mRNA 
0   NM_141394.2  CG10284-RA (CG10284), mRNA 
0   NM_132064.2  CG4666-RA (CG4666), mRNA 
0   NM_137423.1  CG18635-RA (CG18635), mRNA 
0   12  NM_166525.1  CG3413-RC, transcript variant C (wdp), mRNA 
0   12  NM_166524.1  CG3413-RA, transcript variant A (wdp), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.