National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
Notice:

Suspension of shipments during Golden Week Holidays: From 30 April to 14 May, deadline 17 April.

NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 13339R-2 
 Symbol CG13339  Full Name CG13339 
 CG No CG13339  Old CG No CG13339 
 Synonyms BcDNA:RE69336, CG13339 
 Accession No (Link to NCBI) NM_137059.2 
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees viable 
 Map Viewer
 Reference
[Please submit your publication]
Umemori M, Habara O, Iwata T, Maeda K, Nishinoue K, Okabe A, Takemura M, Takahashi K, Saigo K, Ueda R, Adachi-Yamada T.
RNAi-mediated knockdown showing impaired cell survival in Drosophila wing imaginal disc.
Gene Regul Syst Bio (2009) 3 11-20 [ PubMed ID = 19838331 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgGCAGAAACCACTGGTGTGCAA 
 Primer Seq. 3'
aatctagaggtaccATTTCGGTCCAGAAGGCCTGA 
 Predicted Fragment Size
434 
 IR fragment full Seq
0001 GCAGCAAACC ACTGGTGTGC AAATAAAACT GGAACAGCAA AACATCAAGG AGCGCCTGAA 
0061 TCTGCACGTC AAGCGGCGCC TGCAGCAGGA TGCGGATAAT CCCGCCGAGA GTCCCGAATT 
0121 GCTGCCCACC GATGCGAATg CCAAGCGCAG CAAGACGAAA GATGTCTCAA AACCAAGAAA 
0181 ACCCTACCAA AAACGGACAG AAAAACCGAA AACAGAGGCG ACCAAGTGCA AGAAAGTTGG 
0241 ACAATTGGGC AGTCCGGCGG GTGAAGTGGA TCCAATGGAT GACCAGGAGA CGGAAGGCTT 
0301 TTCCCCGGAG GCGCCGGATG GCAAATCCGC CAGACGGGAT TGCTGCAAAA ATGCCGACAT 
0361 CCTCAACATA GTTTTGAACG CTAAGAAACG TAGTTTAATG CAGGATCCTG AAGTTCAGGC 
0421 CTTCTGGACC GAAAT 
 in silico PCR Fragment
0001 GCAG-AAACC ACTGGTGTGC AAATAAAACT GGAACAGCAA AACATCAAGG AGCGCCTGAA 
0061 TCTGCACGTC AAGCGGCGCC TGCAGCAGGA TGCGGATAAT CCCGCCGAGA GTCCCGAATT 
0121 GCTGCCCACC GATGCGAATG CCAAGCGCAG CAAGACGAAA GATGTCTCAA AACCAAGAAA 
0181 ACCCTACCAA AAACGGACAG AAAAACCGAA AACAGAGGCG ACCAAGTGCA AGAAAGTTGG 
0241 ACAATTGGGC AGTCCGGCGG GTGAAGTGGA TCCAATGGAT GACCAGGAGA CGGAAGGCTT 
0301 TTCCCCGGAG GCGCCGGATG GCAAATCCGC CAGACGGGAT TGCTGCAAAA ATGCCGACAT 
0361 CCTCAACATA GTTTTGAACG CTAAGAAACG TAGTTTAATG CAGGATCCTG AAGTTCAGGC 
0421 CTTCTGGACC GAAAT 
 Assemble Data

13339R-2.IR_full       1   GCAGCAAACCACTGGTGTGCAAATAAAACTGGAACAGCAAAACATCAAGGAGCGCCTGAA 60
                           |||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||
13339R-2.in silico     1   GCAG-AAACCACTGGTGTGCAAATAAAACTGGAACAGCAAAACATCAAGGAGCGCCTGAA 60


13339R-2.IR_full       61  TCTGCACGTCAAGCGGCGCCTGCAGCAGGATGCGGATAATCCCGCCGAGAGTCCCGAATT 120
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
13339R-2.in silico     61  TCTGCACGTCAAGCGGCGCCTGCAGCAGGATGCGGATAATCCCGCCGAGAGTCCCGAATT 120


13339R-2.IR_full       121 GCTGCCCACCGATGCGAATGCCAAGCGCAGCAAGACGAAAGATGTCTCAAAACCAAGAAA 180
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
13339R-2.in silico     121 GCTGCCCACCGATGCGAATGCCAAGCGCAGCAAGACGAAAGATGTCTCAAAACCAAGAAA 180


13339R-2.IR_full       181 ACCCTACCAAAAACGGACAGAAAAACCGAAAACAGAGGCGACCAAGTGCAAGAAAGTTGG 240
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
13339R-2.in silico     181 ACCCTACCAAAAACGGACAGAAAAACCGAAAACAGAGGCGACCAAGTGCAAGAAAGTTGG 240


13339R-2.IR_full       241 ACAATTGGGCAGTCCGGCGGGTGAAGTGGATCCAATGGATGACCAGGAGACGGAAGGCTT 300
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
13339R-2.in silico     241 ACAATTGGGCAGTCCGGCGGGTGAAGTGGATCCAATGGATGACCAGGAGACGGAAGGCTT 300


13339R-2.IR_full       301 TTCCCCGGAGGCGCCGGATGGCAAATCCGCCAGACGGGATTGCTGCAAAAATGCCGACAT 360
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
13339R-2.in silico     301 TTCCCCGGAGGCGCCGGATGGCAAATCCGCCAGACGGGATTGCTGCAAAAATGCCGACAT 360


13339R-2.IR_full       361 CCTCAACATAGTTTTGAACGCTAAGAAACGTAGTTTAATGCAGGATCCTGAAGTTCAGGC 420
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
13339R-2.in silico     361 CCTCAACATAGTTTTGAACGCTAAGAAACGTAGTTTAATGCAGGATCCTGAAGTTCAGGC 420


13339R-2.IR_full       421 CTTCTGGACCGAAAT 435
                           |||||||||||||||
13339R-2.in silico     421 CTTCTGGACCGAAAT 435

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   416  NM_137059.2  CG13339-RA (CG13339), mRNA 
0   NM_058022.3  CG3059-RA, transcript variant A (NTPase), mRNA 
0   NM_164514.2  CG3059-RC, transcript variant C (NTPase), mRNA 
0   NM_164513.2  CG3059-RB, transcript variant B (NTPase), mRNA 
0   NM_164515.2  CG3059-RD, transcript variant D (NTPase), mRNA 
0   NM_206045.1  CG3572-RC, transcript variant C (vimar), mRNA 
0   NM_057957.4  CG3572-RB, transcript variant B (vimar), mRNA 
0   NM_079736.2  CG10868-RA, transcript variant A (orb), mRNA 
0   NM_170062.1  CG10868-RB, transcript variant B (orb), mRNA 
0   NM_170064.1  CG10868-RC, transcript variant C (orb), mRNA 
0   NM_135760.1  CG5204-RA (CG5204), mRNA 
0   NM_143534.2  CG15533-RA (CG15533), mRNA 
0   NM_206175.2  CG8201-RF, transcript variant F (par-1), mRNA 
0   NM_206176.2  CG8201-RD, transcript variant D (par-1), mRNA 
0   NM_001014541.1  CG8201-RM, transcript variant M (par-1), mRNA 
0   NM_206173.2  CG8201-RC, transcript variant C (par-1), mRNA 
0   NM_206172.1  CG8201-RG, transcript variant G (par-1), mRNA 
0   NM_206174.2  CG8201-RE, transcript variant E (par-1), mRNA 
0   NM_135602.2  CG6743-RA (Nup170), mRNA 
0   NM_135262.1  CG13786-RA (CG13786), mRNA 
0   NM_132239.1  CG1632-RA (CG1632), mRNA 
0   NM_138163.1  CG7036-RA, transcript variant A (rno), mRNA 
0   NM_206222.1  CG7036-RB, transcript variant B (rno), mRNA 
0   NM_137831.2  CG4752-RA (CG4752), mRNA 
0   NM_143544.2  CG1546-RA, transcript variant A (PH4alphaSG2), mRNA 
0   NM_170494.1  CG1546-RB, transcript variant B (PH4alphaSG2), mRNA 
0   NM_142590.1  CG4465-RA (CG4465), mRNA 
0   NM_078559.2  CG18085-RA (sev), mRNA 
0   NM_206295.1  CG33275-RB, transcript variant B (CG33275), mRNA 
0   NM_079544.3  CG2505-RA (alpha-Est2), mRNA 
 Wing Disc
GFP
Puc
Caspase
DAPI
Merge
Figure
JNK signal
N
 
DB
 
DC
+- 
DM
 
VM
 
VB
 
Caspase-3 signal
N
DB
DC
DM
VM
 
VB
 
Dcompartment   Penetrance
     

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.