National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock discarded request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 13325R-1 
 Symbol CG13325  Full Name CG13325 
 CG No CG13325  Old CG No CG13325 
 Synonyms CG13325 
 Accession No (Link to NCBI) NM_136992.2 
 Inserted Chr. ll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
 Reference
[Please submit your publication]
 
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgATAGTGACGATGTGTTACCGC 
 Primer Seq. 3'
aatctagaggtaccGGCTGAACTTGGAACACTGAC 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 ATAGTGACGA TGTGTTACCG CAGTTTCGGA ATGTCAGGCA ACTTAGGTCC TTGGGCATCG 
0061 AATTTACCGA ATACTTTCGA AATATTTCCA CGCAAGATTT AGGCGGCTTG GAGTCCCAGT 
0121 TTTCGAGTGA AGATGATCTG CTGTGCCTCA ACGATATGAA GGCGCTGATG ACAGGACTTG 
0181 GAAGTGCTGA GTACTGGGCG TTGAAAATGA TCGATGCCTG GGGGTCCATT CCATCGGGAC 
0241 TACTCGCCGG TAATTCGTAT GACCTGGGCA ACTTTGACGA GTGTCTGAAC ATCAGAAAGG 
0301 AGATCGGCCA GGAGAGAACT ATTCAAGTGA AAGTACTGCT TCCTCTCGGT ATCCCCTGCC 
0361 AAAATCCTGG GGATCGAAAC AAGCATAGGT AGCTTCAGAA CTGCCACTTG CTTTCCTGCA 
0421 TCCTGCTCGG CGATCAACAT GAATGCGTTT GTGGATCAAT TGATGATGAA GTTACTCAAT 
0481 GTCAGTGTTC CAAGTTCAGC C 
 in silico PCR Fragment
0001 ATAGTGACGA TGTGTTACCG CAGTTTCGGA ATGTCAGGCA ACTTAGGTCC TTGGGCATCG 
0061 AATTTACCGA ATACTTTCGA AATATTTCCA CGCAAGATTT AGGCGGCTTG GAGTCCCAGT 
0121 TTTCGAGTGA AGATGATCTG CTGTGCCTCA ACGATATGAA GGCGCTGATG ACAGGACTTG 
0181 GAAGTGCTGA GTACTGGGCG TTGAAAATGA TCGATGCCTG GGGGTCCATT CCATCGGGAC 
0241 TACTCGCCGG TAATTCGTAT GACCTGGGCA ACTTTGACGA GTGTCTGAAC ATCAGAAAGG 
0301 AGATCGGCCA GGAGAGAACT ATTCAAG-GA AAGTACTGCT TCCTCTCGGT ATCCCCTGCC 
0361 AAAATCCTGG GGATCGAAAC AAGCATAGGT AGCTTCAGAA CTGCCACTTG CTTTCCTGCA 
0421 TCCTGCTCGG CGATCAACAT GAATGCGTTT GTGGATCAAT TGATGATGAA GTTACTCAAT 
0481 GTCAGTGTTC CAAGTTCAGC C 
 Assemble Data

13325R-1.IR_full       1   ATAGTGACGATGTGTTACCGCAGTTTCGGAATGTCAGGCAACTTAGGTCCTTGGGCATCG 60
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
13325R-1.in silico     1   ATAGTGACGATGTGTTACCGCAGTTTCGGAATGTCAGGCAACTTAGGTCCTTGGGCATCG 60


13325R-1.IR_full       61  AATTTACCGAATACTTTCGAAATATTTCCACGCAAGATTTAGGCGGCTTGGAGTCCCAGT 120
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
13325R-1.in silico     61  AATTTACCGAATACTTTCGAAATATTTCCACGCAAGATTTAGGCGGCTTGGAGTCCCAGT 120


13325R-1.IR_full       121 TTTCGAGTGAAGATGATCTGCTGTGCCTCAACGATATGAAGGCGCTGATGACAGGACTTG 180
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
13325R-1.in silico     121 TTTCGAGTGAAGATGATCTGCTGTGCCTCAACGATATGAAGGCGCTGATGACAGGACTTG 180


13325R-1.IR_full       181 GAAGTGCTGAGTACTGGGCGTTGAAAATGATCGATGCCTGGGGGTCCATTCCATCGGGAC 240
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
13325R-1.in silico     181 GAAGTGCTGAGTACTGGGCGTTGAAAATGATCGATGCCTGGGGGTCCATTCCATCGGGAC 240


13325R-1.IR_full       241 TACTCGCCGGTAATTCGTATGACCTGGGCAACTTTGACGAGTGTCTGAACATCAGAAAGG 300
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
13325R-1.in silico     241 TACTCGCCGGTAATTCGTATGACCTGGGCAACTTTGACGAGTGTCTGAACATCAGAAAGG 300


13325R-1.IR_full       301 AGATCGGCCAGGAGAGAACTATTCAAGTGAAAGTACTGCTTCCTCTCGGTATCCCCTGCC 360
                           ||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||
13325R-1.in silico     301 AGATCGGCCAGGAGAGAACTATTCAAG-GAAAGTACTGCTTCCTCTCGGTATCCCCTGCC 360


13325R-1.IR_full       361 AAAATCCTGGGGATCGAAACAAGCATAGGTAGCTTCAGAACTGCCACTTGCTTTCCTGCA 420
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
13325R-1.in silico     361 AAAATCCTGGGGATCGAAACAAGCATAGGTAGCTTCAGAACTGCCACTTGCTTTCCTGCA 420


13325R-1.IR_full       421 TCCTGCTCGGCGATCAACATGAATGCGTTTGTGGATCAATTGATGATGAAGTTACTCAAT 480
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
13325R-1.in silico     421 TCCTGCTCGGCGATCAACATGAATGCGTTTGTGGATCAATTGATGATGAAGTTACTCAAT 480


13325R-1.IR_full       481 GTCAGTGTTCCAAGTTCAGCC 501
                           |||||||||||||||||||||
13325R-1.in silico     481 GTCAGTGTTCCAAGTTCAGCC 501

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_136992.2  CG13325-RA (CG13325), mRNA 
0   NM_141602.2  CG11982-RA (CG11982), mRNA 
0   NM_136056.2  CG10343-RA (CG10343), mRNA 
0   NM_139760.1  CG10472-RA (CG10472), mRNA 
0   NM_134479.1  CG14205-RA (CG14205), mRNA 
0   NM_057604.3  CG1825-RA (Map60), mRNA 
0   NM_134478.1  CG14219-RA (CG14219), mRNA 
0   NM_144487.1  CG5518-RA (sda), mRNA 
0   NM_136864.2  CG13185-RA (CG13185), mRNA 
0   NM_168677.1  CG32164-RA (CG32164), mRNA 
0   NM_001014742.1  CG6146-RC, transcript variant C (Top1), mRNA 
0   NM_078606.3  CG6146-RA, transcript variant A (Top1), mRNA 
0   NM_143703.2  CG18214-RA, transcript variant A (trio), mRNA 
0   NM_167847.1  CG18214-RC, transcript variant C (trio), mRNA 
0   NM_206228.1  CG18214-RF, transcript variant F (trio), mRNA 
0   NM_167850.1  CG18214-RE, transcript variant E (trio), mRNA 
0   NM_167849.1  CG18214-RB, transcript variant B (trio), mRNA 
0   NM_167848.1  CG18214-RD, transcript variant D (trio), mRNA 
0   19  57  NM_142901.1  CG10182-RA (CG10182), mRNA 
0   11  NM_134477.1  CG14204-RA (CG14204), mRNA 
0   NM_166019.1  CG18076-RH, transcript variant H (shot), mRNA 
0   NM_135933.2  CG4891-RA (CG4891), mRNA 
0   NM_079455.3  CG12306-RA, transcript variant A (polo), mRNA 
0   NM_001014592.1  CG12306-RB, transcript variant B (polo), mRNA 
0   NM_137807.2  CG5625-RA, transcript variant A (CG5625), mRNA 
0   NM_166518.1  CG5625-RB, transcript variant B (CG5625), mRNA 
0   NM_132926.1  CG13008-RA, transcript variant A (CG13008), mRNA 
0   NM_134701.2  CG3883-RA (CG3883), mRNA 
0   20  NM_142903.2  CG10183-RA (CG10183), mRNA 
0   NM_142643.1  CG15923-RA (CG15923), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.