National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock discarded request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 13296R-2 
 Symbol CG13296  Full Name CG13296 
 CG No CG13296  Old CG No CG13296 
 Synonyms CG13296 
 Accession No (Link to NCBI) NM_139775.1 
 Inserted Chr. ll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees viable 
 Map Viewer
[Please submit your publication]
Saj A, Arziman Z, Stempfle D, van Belle W, Sauder U, Horn T, D├╝rrenberger M, Paro R, Boutros M, Merdes G.
A combined ex vivo and in vivo RNAi screen for notch regulators in Drosophila reveals an extensive notch interaction network.
Dev. Cell (2010) 18(5) 862-76 [ PubMed ID = 20493818 ] [ RRC reference ]

Tiwari P, Kumar A, Das RN, Malhotra V, VijayRaghavan K.
A Tendon Cell Specific RNAi Screen Reveals Novel Candidates Essential for Muscle Tendon Interaction.
PLoS ONE (2015) 10(10) e0140976 [ PubMed ID = 26488612 ] [ RRC reference ]  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
 Primer Seq. 3'
 Predicted Fragment Size
 IR fragment full Seq
 in silico PCR Fragment
 Assemble Data

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     1   ACACGACAGCTCAACTGGATAGTCTGGAGCAGAAGCGCTCGGCCAGCCTGATCTTCCGAA 60

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     61  TTGAGCAACTCCTGCCGAGCACCAGTATCACACCGACCAGCATGACCACTTCATCGACAG 120

                           ||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| silico     121 AAACCACATTGACGGCCACCACGAGCACCGC-AAGTCCGGCCAAGCGGATGAGGATGAGC 180

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     181 AATCCACGACCAGGTGTTTACGCCTCGCAGTACACGCCCAAGGATACCTGCTCCATGGCC 240

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     241 ATTCCCACGTCGGCTCTCCTGGGATCTACGGTCATGCCCACGGATGGCAGCCGCTCCCAC 300

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     301 TGCCAGCTGTCCAATGGCGAACTAATCGTATCCGGTTCACTGTTGCGGCAGATCAAACTC 360

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     361 TCCGAGGATGTGTATAGCTTCAATGCCATCTTCGAACTGCATGGTGGACAAGTGCGCGTC 420

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     421 CGTTTGGTCAGGGATGTAGCCCGGGAGGACGAGATCGTGGCCTGGTTCGGTGAGGAGTTG 480

13296R-2.IR_full       481 GTTCTCCTTATGGGCATTCCC 501
                           ||||||||||||||||||||| silico     481 GTTCTCCTTATGGGCATTCCC 501

 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_139775.1  CG13296-RA (CG13296), mRNA 
0   NM_079751.3  CG31136-RA (Syx1A), mRNA 
0   NM_167223.1  CG32684-RA, transcript variant A (alpha-Man-I), mRNA 
0   NM_206675.1  CG32684-RD, transcript variant D (alpha-Man-I), mRNA 
0   NM_206676.1  CG32684-RC, transcript variant C (alpha-Man-I), mRNA 
0   NM_206672.1  CG32684-RG, transcript variant G (alpha-Man-I), mRNA 
0   NM_206673.1  CG32684-RF, transcript variant F (alpha-Man-I), mRNA 
0   NM_206674.1  CG32684-RE, transcript variant E (alpha-Man-I), mRNA 
0   NM_078550.2  CG32684-RB, transcript variant B (alpha-Man-I), mRNA 
0   NM_135663.2  CG14929-RA, transcript variant A (CG14929), mRNA 
0   NM_135662.3  CG4970-RA, transcript variant A (CG4970), mRNA 
0   NM_137448.2  CG5756-RA, transcript variant A (CG5756), mRNA 
0   NM_176223.2  CG30115-RD, transcript variant D (CG30115), mRNA 
0   NM_140689.3  CG6652-RA, transcript variant A (CG6652), mRNA 
0   NM_168712.2  CG6652-RB, transcript variant B (CG6652), mRNA 
0   NM_135082.2  CG6604-RA (H15), mRNA 
0   NM_170087.1  CG10365-RC, transcript variant C (CG10365), mRNA 
0   NM_206547.1  CG10365-RD, transcript variant D (CG10365), mRNA 
0   NM_170086.1  CG10365-RB, transcript variant B (CG10365), mRNA 
0   NM_142919.1  CG10365-RA, transcript variant A (CG10365), mRNA 
0   NM_140351.2  CG11010-RA (Ent3), mRNA 
0   NM_166126.1  CG18255-RC, transcript variant C (Strn-Mlck), mRNA 
0   NM_166130.1  CG18255-RE, transcript variant E (Strn-Mlck), mRNA 
0   NM_140007.1  CG5747-RA (mfr), mRNA 
0   NM_142238.2  CG4576-RA (CG4576), mRNA 
0   NM_166125.2  CG18255-RA, transcript variant A (Strn-Mlck), mRNA 
0   NM_166129.2  CG18255-RD, transcript variant D (Strn-Mlck), mRNA 
0   NM_170654.1  CG10772-RA, transcript variant A (Fur1), mRNA 
0   NM_079609.2  CG6019-RA (mus308), mRNA 
0   NM_135124.1  CG14001-RA (bchs), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.