National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 13296R-1 
 Symbol CG13296  Full Name CG13296 
 CG No CG13296  Old CG No CG13296 
 Synonyms CG13296 
 Accession No (Link to NCBI) NM_139775.1 
 Inserted Chr. ll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees viable 
 Map Viewer
 Reference
[Please submit your publication]
Saj A, Arziman Z, Stempfle D, van Belle W, Sauder U, Horn T, D├╝rrenberger M, Paro R, Boutros M, Merdes G.
A combined ex vivo and in vivo RNAi screen for notch regulators in Drosophila reveals an extensive notch interaction network.
Dev. Cell (2010) 18(5) 862-76 [ PubMed ID = 20493818 ] [ RRC reference ]

Tiwari P, Kumar A, Das RN, Malhotra V, VijayRaghavan K.
A Tendon Cell Specific RNAi Screen Reveals Novel Candidates Essential for Muscle Tendon Interaction.
PLoS ONE (2015) 10(10) e0140976 [ PubMed ID = 26488612 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgACACGACAGCTCAACTGGATA 
 Primer Seq. 3'
aatctagaggtaccGGGAATGCCCATAAGGAGAAC 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 ACACGACAGC TCAACTGGAT AGTCTGGAGC AGAAGCGCTC GGCCAGCCTG ATCTTCCGAA 
0061 TTGAGCAACT CCTGCCGAGC ACCAGTATCA CACCGACCAG CATGACCACT TCATCGACAG 
0121 AAACCACATT GACGGCCACC ACGAGCACCG CNAAGTCCGG CCAAGCGGAT GAGGATGAGC 
0181 AATCCACGAC CAGGTGTTTA CGCCTCGCAG TACACGCCCA AGGATACCTG CTCCATGGCC 
0241 ATTCCCACGT CGGCTCTCCT GGGATCTACG GTCATGCCCA CGGATGGCAG CCGCTCCCAC 
0301 TGCCAGCTGT CCAATGGCGA ACTAATCGTA TCCGGTTCAC TGTTGCGGCA GATCAAACTC 
0361 TCCGAGGATG TGTATAGCTT CAATGCCATC TTCGAACTGC ATGGTGGACA AGTGCGCGTC 
0421 CGTTTGGTCA GGGATGTAGC CCGGGAGGAC GAGATCGTGG CCTGGTTCGG TGAGGAGTTG 
0481 GTTCTCCTTA TGGGCATTCC C 
 in silico PCR Fragment
0001 ACACGACAGC TCAACTGGAT AGTCTGGAGC AGAAGCGCTC GGCCAGCCTG ATCTTCCGAA 
0061 TTGAGCAACT CCTGCCGAGC ACCAGTATCA CACCGACCAG CATGACCACT TCATCGACAG 
0121 AAACCACATT GACGGCCACC ACGAGCACCG C-AAGTCCGG CCAAGCGGAT GAGGATGAGC 
0181 AATCCACGAC CAGGTGTTTA CGCCTCGCAG TACACGCCCA AGGATACCTG CTCCATGGCC 
0241 ATTCCCACGT CGGCTCTCCT GGGATCTACG GTCATGCCCA CGGATGGCAG CCGCTCCCAC 
0301 TGCCAGCTGT CCAATGGCGA ACTAATCGTA TCCGGTTCAC TGTTGCGGCA GATCAAACTC 
0361 TCCGAGGATG TGTATAGCTT CAATGCCATC TTCGAACTGC ATGGTGGACA AGTGCGCGTC 
0421 CGTTTGGTCA GGGATGTAGC CCGGGAGGAC GAGATCGTGG CCTGGTTCGG TGAGGAGTTG 
0481 GTTCTCCTTA TGGGCATTCC C 
 Assemble Data

13296R-1.IR_full       1   ACACGACAGCTCAACTGGATAGTCTGGAGCAGAAGCGCTCGGCCAGCCTGATCTTCCGAA 60
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
13296R-1.in silico     1   ACACGACAGCTCAACTGGATAGTCTGGAGCAGAAGCGCTCGGCCAGCCTGATCTTCCGAA 60


13296R-1.IR_full       61  TTGAGCAACTCCTGCCGAGCACCAGTATCACACCGACCAGCATGACCACTTCATCGACAG 120
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
13296R-1.in silico     61  TTGAGCAACTCCTGCCGAGCACCAGTATCACACCGACCAGCATGACCACTTCATCGACAG 120


13296R-1.IR_full       121 AAACCACATTGACGGCCACCACGAGCACCGCNAAGTCCGGCCAAGCGGATGAGGATGAGC 180
                           ||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||
13296R-1.in silico     121 AAACCACATTGACGGCCACCACGAGCACCGC-AAGTCCGGCCAAGCGGATGAGGATGAGC 180


13296R-1.IR_full       181 AATCCACGACCAGGTGTTTACGCCTCGCAGTACACGCCCAAGGATACCTGCTCCATGGCC 240
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
13296R-1.in silico     181 AATCCACGACCAGGTGTTTACGCCTCGCAGTACACGCCCAAGGATACCTGCTCCATGGCC 240


13296R-1.IR_full       241 ATTCCCACGTCGGCTCTCCTGGGATCTACGGTCATGCCCACGGATGGCAGCCGCTCCCAC 300
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
13296R-1.in silico     241 ATTCCCACGTCGGCTCTCCTGGGATCTACGGTCATGCCCACGGATGGCAGCCGCTCCCAC 300


13296R-1.IR_full       301 TGCCAGCTGTCCAATGGCGAACTAATCGTATCCGGTTCACTGTTGCGGCAGATCAAACTC 360
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
13296R-1.in silico     301 TGCCAGCTGTCCAATGGCGAACTAATCGTATCCGGTTCACTGTTGCGGCAGATCAAACTC 360


13296R-1.IR_full       361 TCCGAGGATGTGTATAGCTTCAATGCCATCTTCGAACTGCATGGTGGACAAGTGCGCGTC 420
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
13296R-1.in silico     361 TCCGAGGATGTGTATAGCTTCAATGCCATCTTCGAACTGCATGGTGGACAAGTGCGCGTC 420


13296R-1.IR_full       421 CGTTTGGTCAGGGATGTAGCCCGGGAGGACGAGATCGTGGCCTGGTTCGGTGAGGAGTTG 480
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
13296R-1.in silico     421 CGTTTGGTCAGGGATGTAGCCCGGGAGGACGAGATCGTGGCCTGGTTCGGTGAGGAGTTG 480


13296R-1.IR_full       481 GTTCTCCTTATGGGCATTCCC 501
                           |||||||||||||||||||||
13296R-1.in silico     481 GTTCTCCTTATGGGCATTCCC 501

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_139775.1  CG13296-RA (CG13296), mRNA 
0   NM_079751.3  CG31136-RA (Syx1A), mRNA 
0   NM_167223.1  CG32684-RA, transcript variant A (alpha-Man-I), mRNA 
0   NM_206675.1  CG32684-RD, transcript variant D (alpha-Man-I), mRNA 
0   NM_206676.1  CG32684-RC, transcript variant C (alpha-Man-I), mRNA 
0   NM_206672.1  CG32684-RG, transcript variant G (alpha-Man-I), mRNA 
0   NM_206673.1  CG32684-RF, transcript variant F (alpha-Man-I), mRNA 
0   NM_206674.1  CG32684-RE, transcript variant E (alpha-Man-I), mRNA 
0   NM_078550.2  CG32684-RB, transcript variant B (alpha-Man-I), mRNA 
0   NM_135663.2  CG14929-RA, transcript variant A (CG14929), mRNA 
0   NM_135662.3  CG4970-RA, transcript variant A (CG4970), mRNA 
0   NM_137448.2  CG5756-RA, transcript variant A (CG5756), mRNA 
0   NM_176223.2  CG30115-RD, transcript variant D (CG30115), mRNA 
0   NM_140689.3  CG6652-RA, transcript variant A (CG6652), mRNA 
0   NM_168712.2  CG6652-RB, transcript variant B (CG6652), mRNA 
0   NM_135082.2  CG6604-RA (H15), mRNA 
0   NM_170087.1  CG10365-RC, transcript variant C (CG10365), mRNA 
0   NM_206547.1  CG10365-RD, transcript variant D (CG10365), mRNA 
0   NM_170086.1  CG10365-RB, transcript variant B (CG10365), mRNA 
0   NM_142919.1  CG10365-RA, transcript variant A (CG10365), mRNA 
0   NM_140351.2  CG11010-RA (Ent3), mRNA 
0   NM_166126.1  CG18255-RC, transcript variant C (Strn-Mlck), mRNA 
0   NM_166130.1  CG18255-RE, transcript variant E (Strn-Mlck), mRNA 
0   NM_140007.1  CG5747-RA (mfr), mRNA 
0   NM_142238.2  CG4576-RA (CG4576), mRNA 
0   NM_166125.2  CG18255-RA, transcript variant A (Strn-Mlck), mRNA 
0   NM_166129.2  CG18255-RD, transcript variant D (Strn-Mlck), mRNA 
0   NM_170654.1  CG10772-RA, transcript variant A (Fur1), mRNA 
0   NM_079609.2  CG6019-RA (mus308), mRNA 
0   NM_135124.1  CG14001-RA (bchs), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.