National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock discarded request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 13258R-3 
 Symbol CG13258  Full Name CG13258 
 CG No CG13258  Old CG No CG13258 
 Synonyms CG13258 
 Accession No (Link to NCBI) NM_135941.1 
 Inserted Chr. ll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees viable 
 Map Viewer
 Reference
[Please submit your publication]
 
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgGCCATGTACATGATGCATCTG 
 Primer Seq. 3'
aatctagaggtaccGCGGAGTAGAGGCAAAATGGA 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 gCCATGTANC ATGATGCATC TGCTCGCCCA GGATTGGGTG AAGATCCGAC CCATTCGCGG 
0061 AATAACCCAA CTAGCCGGAA TGGCCGCTCA GCCGATCCAA CAGGTTATTG CACCCATTCA 
0121 ACAGGCCAGC GGGGCGCTAA ATTTATTCCG GAGCAGGAGA GAGGCCAGCC TGAATCACGA 
0181 ACTCGGTTGG GTGCGAAGGA CCCAAGATTC GGGTGGGGGC AATGGTGCCA GAGGTGGGGG 
0241 CGCGAATCAC AGGCCACCAC CTGCCGTCGA TTGGAAGAGG ATCCTGTCGA GAGATCCCTT 
0301 CGAGTGCCTG CAATCGTTGA TATGCCAACT GATGTCCGGA GCGGAAGCGA AAGTTCCAGA 
0361 GGCTGAGTTG CTCATGGATT ATCTGGAGTC ATCGCTTGAG CTGGCACCGG CCAAAATTGG 
0421 TCGCGCCTTC AGTCGAGGAT TGGCCTTGAG AGGCAGCACG GAGCTGTGCT ACAACGAATA 
0481 TCCATTTTGC CTCTACTCCG C 
 in silico PCR Fragment
0001 GCCATGTA-C ATGATGCATC TGCTCGCCCA GGATTGGGTG AAGATCCGAC CCATTCGCGG 
0061 AATAACCCAA CTAGCCGGAA TGGCCGCTCA GCCGATCCAA CAGGTTATTG CACCCATTCA 
0121 ACAGGCCAGC GGGGCTCTTA ATTTATTCCG GAGCAGGAGA GAGGCCAGCC TGAATCACGA 
0181 ACTCGGTTGG GTGCGAAGGA CCCAAGATTC GGGTGGGGGC AATGGTGCCA GAGGTGGGGG 
0241 CGCGGATCAC AGGCCACCAC CTGCCGTCGA TTGGAAGAGG ATCCTGTCGA GAGATCCCTT 
0301 CGAGTGCCTG CAATCGTTGA TATGCCAACT GATGTCCGGA GCGGAAGCGA AAGTTCCAGA 
0361 GGCTGAGTTG CTCATGGATT ATCTGGAGTC ATCGCTGGAG CTGGCACCGG CCAAAATTGG 
0421 TCGCGCCTTC AGTCGAGGAT TGGCCTTGAG AGGCAGCACG GAGCTGTGCT ACAACGAATA 
0481 TCCATTTTGC CTCTACTCCG C 
 Assemble Data

13258R-3.IR_full       1   GCCATGTANCATGATGCATCTGCTCGCCCAGGATTGGGTGAAGATCCGACCCATTCGCGG 60
                           |||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||
13258R-3.in silico     1   GCCATGTA-CATGATGCATCTGCTCGCCCAGGATTGGGTGAAGATCCGACCCATTCGCGG 60


13258R-3.IR_full       61  AATAACCCAACTAGCCGGAATGGCCGCTCAGCCGATCCAACAGGTTATTGCACCCATTCA 120
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
13258R-3.in silico     61  AATAACCCAACTAGCCGGAATGGCCGCTCAGCCGATCCAACAGGTTATTGCACCCATTCA 120


13258R-3.IR_full       121 ACAGGCCAGCGGGGCGCTAAATTTATTCCGGAGCAGGAGAGAGGCCAGCCTGAATCACGA 180
                           ||||||||||||||| || |||||||||||||||||||||||||||||||||||||||||
13258R-3.in silico     121 ACAGGCCAGCGGGGCTCTTAATTTATTCCGGAGCAGGAGAGAGGCCAGCCTGAATCACGA 180


13258R-3.IR_full       181 ACTCGGTTGGGTGCGAAGGACCCAAGATTCGGGTGGGGGCAATGGTGCCAGAGGTGGGGG 240
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
13258R-3.in silico     181 ACTCGGTTGGGTGCGAAGGACCCAAGATTCGGGTGGGGGCAATGGTGCCAGAGGTGGGGG 240


13258R-3.IR_full       241 CGCGAATCACAGGCCACCACCTGCCGTCGATTGGAAGAGGATCCTGTCGAGAGATCCCTT 300
                           |||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||
13258R-3.in silico     241 CGCGGATCACAGGCCACCACCTGCCGTCGATTGGAAGAGGATCCTGTCGAGAGATCCCTT 300


13258R-3.IR_full       301 CGAGTGCCTGCAATCGTTGATATGCCAACTGATGTCCGGAGCGGAAGCGAAAGTTCCAGA 360
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
13258R-3.in silico     301 CGAGTGCCTGCAATCGTTGATATGCCAACTGATGTCCGGAGCGGAAGCGAAAGTTCCAGA 360


13258R-3.IR_full       361 GGCTGAGTTGCTCATGGATTATCTGGAGTCATCGCTTGAGCTGGCACCGGCCAAAATTGG 420
                           |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||
13258R-3.in silico     361 GGCTGAGTTGCTCATGGATTATCTGGAGTCATCGCTGGAGCTGGCACCGGCCAAAATTGG 420


13258R-3.IR_full       421 TCGCGCCTTCAGTCGAGGATTGGCCTTGAGAGGCAGCACGGAGCTGTGCTACAACGAATA 480
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
13258R-3.in silico     421 TCGCGCCTTCAGTCGAGGATTGGCCTTGAGAGGCAGCACGGAGCTGTGCTACAACGAATA 480


13258R-3.IR_full       481 TCCATTTTGCCTCTACTCCGC 501
                           |||||||||||||||||||||
13258R-3.in silico     481 TCCATTTTGCCTCTACTCCGC 501

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_135941.1  CG13258-RA (CG13258), mRNA 
0   NM_168294.1  CG32030-RB, transcript variant B (CG32030), mRNA 
0   NM_168293.1  CG32030-RA, transcript variant A (CG32030), mRNA 
0   NM_167297.1  CG1830-RC, transcript variant C (PhKgamma), mRNA 
0   NM_167296.1  CG1830-RB, transcript variant B (PhKgamma), mRNA 
0   NM_078574.2  CG1830-RA, transcript variant A (PhKgamma), mRNA 
0   NM_143031.1  CG11375-RA (polybromo), mRNA 
0   NM_140476.2  CG5392-RA (CG5392), mRNA 
0   NM_134992.2  CG15439-RA (CG15439), mRNA 
0   NM_164444.1  CG31663-RA (CG31663), mRNA 
0   NM_164569.2  CG31774-RA (fred), mRNA 
0   NM_001042828.1  CG41481-RA (CG41481), mRNA 
0   NM_167157.1  CG12117-RA (Sptr), mRNA 
0   NM_136557.2  CG8635-RA (CG8635), mRNA 
0   NM_168755.1  CG8127-RB, transcript variant B (Eip75B), mRNA 
0   NM_079738.2  CG6768-RA (DNApol-epsilon), mRNA 
0   NM_168756.1  CG8127-RC, transcript variant C (Eip75B), mRNA 
0   NM_079409.2  CG8127-RA, transcript variant A (Eip75B), mRNA 
0   NM_168757.1  CG8127-RD, transcript variant D (Eip75B), mRNA 
0   NM_139612.1  CG1308-RA (CG1308), mRNA 
0   NM_134933.1  CG2774-RA (CG2774), mRNA 
0   NM_136585.1  CG13745-RA (CG13745), mRNA 
0   NM_078599.3  CG18657-RA (NetA), mRNA 
0   NM_080180.2  CG10988-RA (l(1)dd4), mRNA 
0   NM_057804.2  CG1451-RA (Apc), mRNA 
0   NM_169257.1  CG11988-RB, transcript variant B (neur), mRNA 
0   NM_057304.3  CG11988-RA, transcript variant A (neur), mRNA 
0   NM_169255.1  CG11988-RD, transcript variant D (neur), mRNA 
0   NM_169256.1  CG11988-RC, transcript variant C (neur), mRNA 
0   NM_132884.2  CG3632-RD, transcript variant D (CG3632), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.