National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 13258R-1 
 Symbol CG13258  Full Name CG13258 
 CG No CG13258  Old CG No CG13258 
 Synonyms CG13258 
 Accession No (Link to NCBI) NM_135941.1 
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees viable 
 Map Viewer
[Please submit your publication]
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
 Primer Seq. 3'
 Predicted Fragment Size
 IR fragment full Seq
 in silico PCR Fragment
 Assemble Data

                           |||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| silico     1   GCCATGTA-CATGATGCATCTGCTCGCCCAGGATTGGGTGAAGATCCGACCCATTCGCGG 60

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     61  AATAACCCAACTAGCCGGAATGGCCGCTCAGCCGATCCAACAGGTTATTGCACCCATTCA 120

                           ||||||||||||||| || ||||||||||||||||||||||||||||||||||||||||| silico     121 ACAGGCCAGCGGGGCTCTTAATTTATTCCGGAGCAGGAGAGAGGCCAGCCTGAATCACGA 180

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     181 ACTCGGTTGGGTGCGAAGGACCCAAGATTCGGGTGGGGGCAATGGTGCCAGAGGTGGGGG 240

                           |||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     241 CGCGGATCACAGGCCACCACCTGCCGTCGATTGGAAGAGGATCCTGTCGAGAGATCCCTT 300

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     301 CGAGTGCCTGCAATCGTTGATATGCCAACTGATGTCCGGAGCGGAAGCGAAAGTTCCAGA 360

                           |||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| silico     361 GGCTGAGTTGCTCATGGATTATCTGGAGTCATCGCTGGAGCTGGCACCGGCCAAAATTGG 420

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     421 TCGCGCCTTCAGTCGAGGATTGGCCTTGAGAGGCAGCACGGAGCTGTGCTACAACGAATA 480

13258R-1.IR_full       481 TCCATTTTGCCTCTACTCCGC 501
                           ||||||||||||||||||||| silico     481 TCCATTTTGCCTCTACTCCGC 501

 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_135941.1  CG13258-RA (CG13258), mRNA 
0   NM_168294.1  CG32030-RB, transcript variant B (CG32030), mRNA 
0   NM_168293.1  CG32030-RA, transcript variant A (CG32030), mRNA 
0   NM_167297.1  CG1830-RC, transcript variant C (PhKgamma), mRNA 
0   NM_167296.1  CG1830-RB, transcript variant B (PhKgamma), mRNA 
0   NM_078574.2  CG1830-RA, transcript variant A (PhKgamma), mRNA 
0   NM_143031.1  CG11375-RA (polybromo), mRNA 
0   NM_140476.2  CG5392-RA (CG5392), mRNA 
0   NM_134992.2  CG15439-RA (CG15439), mRNA 
0   NM_164444.1  CG31663-RA (CG31663), mRNA 
0   NM_164569.2  CG31774-RA (fred), mRNA 
0   NM_001042828.1  CG41481-RA (CG41481), mRNA 
0   NM_167157.1  CG12117-RA (Sptr), mRNA 
0   NM_136557.2  CG8635-RA (CG8635), mRNA 
0   NM_168755.1  CG8127-RB, transcript variant B (Eip75B), mRNA 
0   NM_079738.2  CG6768-RA (DNApol-epsilon), mRNA 
0   NM_168756.1  CG8127-RC, transcript variant C (Eip75B), mRNA 
0   NM_079409.2  CG8127-RA, transcript variant A (Eip75B), mRNA 
0   NM_168757.1  CG8127-RD, transcript variant D (Eip75B), mRNA 
0   NM_139612.1  CG1308-RA (CG1308), mRNA 
0   NM_134933.1  CG2774-RA (CG2774), mRNA 
0   NM_136585.1  CG13745-RA (CG13745), mRNA 
0   NM_078599.3  CG18657-RA (NetA), mRNA 
0   NM_080180.2  CG10988-RA (l(1)dd4), mRNA 
0   NM_057804.2  CG1451-RA (Apc), mRNA 
0   NM_169257.1  CG11988-RB, transcript variant B (neur), mRNA 
0   NM_057304.3  CG11988-RA, transcript variant A (neur), mRNA 
0   NM_169255.1  CG11988-RD, transcript variant D (neur), mRNA 
0   NM_169256.1  CG11988-RC, transcript variant C (neur), mRNA 
0   NM_132884.2  CG3632-RD, transcript variant D (CG3632), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.