National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock discarded request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 1324R-4 
 Symbol CG1324  Full Name CG1324 
 CG No CG1324  Old CG No CG1324 
 Synonyms anon-WO0140519.192, CG1324 
 Accession No (Link to NCBI) NM_134562.2 
 Inserted Chr. ll 
 Insertional Mutation  lethal 
 Phenotype induced by Act5C-GAL4 at 28 degrees viable 
 Map Viewer
[Please submit your publication]
Rauskolb C, Pan G, Reddy BV, Oh H, Irvine KD.
Zyxin links fat signaling to the hippo pathway.
PLoS Biol. (2011) 9(6) e1000624 [ PubMed ID = 21666802 ] [ RRC reference ]  
 Comment balanced with SM6a, Cy 
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
 Primer Seq. 3'
 Predicted Fragment Size
 IR fragment full Seq
 in silico PCR Fragment
 Assemble Data

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     1   CAAGAGTAGCTGTTCCAGGACACTGATCCTGCTTAACTCCCTGAAATCCATGCACCACAA 60

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     61  GAGCCTGCACGTGGAGCAACTGTTGGAGGCAGCTCCAGCGCCCAAAAACCGCTGCCTGGA 120

                          |||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| silico     121 TCTGTTGGGTCGCTTGATCCATGGCCGATTGAGT-CTCTTGGGCGGTCGTCCTGTCCCGC 180

                          ||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| silico     181 CCAGATTCTTACCGCTATTGGCGGGTGATCGAAGCCTGTACTTTAATGCGGACGAGGACG 240

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     241 AAGAGTTTCGTAAGCGTTTGGCCATGCAGCTGAAGGAGTTGCGAGAGACCCTGCAAGAAA 300

                          | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     301 AACAGGAACTTCGCGAGGGACAAGAGCAGGACTTTCAGGAGCTGGAGCAACAGGACGAGG 360

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     361 AGGAGGATCAGCCGTATGTGCCCAGATCTCGGGAGATCTCCATGGAGGATCTCACTGACG 420

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     421 AGGAGCTAAGTGACGTGCGGGGGCTGCGGATGAGTGCCAGCCAGGATGATGGCAAGTCTG 480

1324R-4.IR_full       481 GTAATTTCGAGCAGCCAGAA 500
                          |||||||||||||||||||| silico     481 GTAATTTCGAGCAGCCAGAA 500

 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   481  NM_134562.2  CG1324-RA (CG1324), mRNA 
0.62   NM_143320.2  CG18437-RA (CG18437), mRNA 
0.41   NM_143508.1  CG7928-RA (CG7928), mRNA 
0.2   NM_079079.2  CG9709-RA (Acox57D-d), mRNA 
0.2   NM_078775.2  CG13780-RA (Pvf2), mRNA 
0   21  NM_167340.1  CG32648-RA (Pde9), mRNA 
0   NM_130505.2  CG13359-RA (CG13359), mRNA 
0   NM_080317.2  CG2647-RA (per), mRNA 
0   12  NM_139725.2  CG5249-RA (Blimp-1), mRNA 
0   NM_166957.1  CG32793-RA (CG32793), mRNA 
0   16  NM_080025.1  CG11387-RA, transcript variant A (ct), mRNA 
0   13  NM_167130.1  CG11387-RB, transcript variant B (ct), mRNA 
0   NM_139976.1  CG6765-RA (CG6765), mRNA 
0   NM_139488.2  CG1240-RA (CG1240), mRNA 
0   NM_137256.1  CG15701-RA (CG15701), mRNA 
0   NM_143452.1  CG1911-RA (CAP-D2), mRNA 
0   NM_132239.1  CG1632-RA (CG1632), mRNA 
0   NM_135310.2  CG7115-RB, transcript variant B (CG7115), mRNA 
0   NM_164774.1  CG7115-RA, transcript variant A (CG7115), mRNA 
0   NM_169500.1  CG8630-RA (CG8630), mRNA 
0   NM_079706.2  CG3412-RA (slmb), mRNA 
0   NM_138247.1  CG9134-RB, transcript variant B (CG9134), mRNA 
0   NM_080118.2  CG2075-RA (aly), mRNA 
0   NM_001042909.1  CG31619-RC, transcript variant C (CG31619), mRNA 
0   NM_165396.1  CG31619-RA, transcript variant A (CG31619), mRNA 
0   NM_079001.2  CG3886-RA (Psc), mRNA 
0   NM_165397.1  CG31619-RB, transcript variant B (CG31619), mRNA 
0   10  NM_078816.2  CG7279-RA (Lip1), mRNA 
0   NM_078667.2  CG6474-RA (e(y)1), mRNA 
0   NM_139450.2  CG5714-RA (ecd), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.