National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 1324R-1 
 Symbol CG1324  Full Name CG1324 
 CG No CG1324  Old CG No CG1324 
 Synonyms anon-WO0140519.192, CG1324 
 Accession No (Link to NCBI) NM_134562.2 
 Inserted Chr. lll 
 Insertional Mutation  semi-lethal 
 Phenotype induced by Act5C-GAL4 at 28 degrees viable 
 Map Viewer
 Reference
[Please submit your publication]
Ohhara Y, Nakamura A, Kato Y, Yamakawa-Kobayashi K.
Chaperonin TRiC/CCT supports mitotic exit and entry into endocycle in Drosophila.
PLoS Genet. (2019) 15(4) e1008121 [ PubMed ID = 31034473 ] [ RRC reference ]

Rauskolb C, Pan G, Reddy BV, Oh H, Irvine KD.
Zyxin links fat signaling to the hippo pathway.
PLoS Biol. (2011) 9(6) e1000624 [ PubMed ID = 21666802 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgCAAGAGTAGCTGTTCCAGGAC 
 Primer Seq. 3'
aatctagaggtaccTTCTGGCTGCTCGAAATTACC 
 Predicted Fragment Size
499 
 IR fragment full Seq
0001 CAAGAGTAGC TGTTCCAGGA CACTGATCCT GCTTAACTCC CTGAAATCCA TGCACCACAA 
0061 GAGCCTGCAC GTGGAGCAAC TGTTGGAGGC AGCTCCAGCG CCCAAAAACC GCTGCCTGGA 
0121 TCTGTTGGGT CGCTTGATCC ATGGCCGATT GAGTACTCTT GGGCGGTCGT CCTGTCCCGC 
0181 CCAGATTCTT ACCGCTATTG GCGGGTGATC GCAGCCTGTA CTTTAATGCG GACGAGGACG 
0241 AAGAGTTTCG TAAGCGTTTG GCCATGCAGC TGAAGGAGTT GCGAGAGACC CTGCAAGAAA 
0301 AGCAGGAACT TCGCGAGGGA CAAGAGCAGG ACTTTCAGGA GCTGGAGCAA CAGGACGAGG 
0361 AGGAGGATCA GCCGTATGTG CCCAGATCTC GGGAGATCTC CATGGAGGAT CTCACTGACG 
0421 AGGAGCTAAG TGACGTGCGG GGGCTGCGGA TGAGTGCCAG CCAGGATGAT GGCAAGTCTG 
0481 GTAATTTCGA GCAGCCAGAA  
 in silico PCR Fragment
0001 CAAGAGTAGC TGTTCCAGGA CACTGATCCT GCTTAACTCC CTGAAATCCA TGCACCACAA 
0061 GAGCCTGCAC GTGGAGCAAC TGTTGGAGGC AGCTCCAGCG CCCAAAAACC GCTGCCTGGA 
0121 TCTGTTGGGT CGCTTGATCC ATGGCCGATT GAGT-CTCTT GGGCGGTCGT CCTGTCCCGC 
0181 CCAGATTCTT ACCGCTATTG GCGGGTGATC GAAGCCTGTA CTTTAATGCG GACGAGGACG 
0241 AAGAGTTTCG TAAGCGTTTG GCCATGCAGC TGAAGGAGTT GCGAGAGACC CTGCAAGAAA 
0301 AACAGGAACT TCGCGAGGGA CAAGAGCAGG ACTTTCAGGA GCTGGAGCAA CAGGACGAGG 
0361 AGGAGGATCA GCCGTATGTG CCCAGATCTC GGGAGATCTC CATGGAGGAT CTCACTGACG 
0421 AGGAGCTAAG TGACGTGCGG GGGCTGCGGA TGAGTGCCAG CCAGGATGAT GGCAAGTCTG 
0481 GTAATTTCGA GCAGCCAGAA  
 Assemble Data

1324R-1.IR_full       1   CAAGAGTAGCTGTTCCAGGACACTGATCCTGCTTAACTCCCTGAAATCCATGCACCACAA 60
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
1324R-1.in silico     1   CAAGAGTAGCTGTTCCAGGACACTGATCCTGCTTAACTCCCTGAAATCCATGCACCACAA 60


1324R-1.IR_full       61  GAGCCTGCACGTGGAGCAACTGTTGGAGGCAGCTCCAGCGCCCAAAAACCGCTGCCTGGA 120
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
1324R-1.in silico     61  GAGCCTGCACGTGGAGCAACTGTTGGAGGCAGCTCCAGCGCCCAAAAACCGCTGCCTGGA 120


1324R-1.IR_full       121 TCTGTTGGGTCGCTTGATCCATGGCCGATTGAGTACTCTTGGGCGGTCGTCCTGTCCCGC 180
                          |||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||
1324R-1.in silico     121 TCTGTTGGGTCGCTTGATCCATGGCCGATTGAGT-CTCTTGGGCGGTCGTCCTGTCCCGC 180


1324R-1.IR_full       181 CCAGATTCTTACCGCTATTGGCGGGTGATCGCAGCCTGTACTTTAATGCGGACGAGGACG 240
                          ||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||
1324R-1.in silico     181 CCAGATTCTTACCGCTATTGGCGGGTGATCGAAGCCTGTACTTTAATGCGGACGAGGACG 240


1324R-1.IR_full       241 AAGAGTTTCGTAAGCGTTTGGCCATGCAGCTGAAGGAGTTGCGAGAGACCCTGCAAGAAA 300
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
1324R-1.in silico     241 AAGAGTTTCGTAAGCGTTTGGCCATGCAGCTGAAGGAGTTGCGAGAGACCCTGCAAGAAA 300


1324R-1.IR_full       301 AGCAGGAACTTCGCGAGGGACAAGAGCAGGACTTTCAGGAGCTGGAGCAACAGGACGAGG 360
                          | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
1324R-1.in silico     301 AACAGGAACTTCGCGAGGGACAAGAGCAGGACTTTCAGGAGCTGGAGCAACAGGACGAGG 360


1324R-1.IR_full       361 AGGAGGATCAGCCGTATGTGCCCAGATCTCGGGAGATCTCCATGGAGGATCTCACTGACG 420
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
1324R-1.in silico     361 AGGAGGATCAGCCGTATGTGCCCAGATCTCGGGAGATCTCCATGGAGGATCTCACTGACG 420


1324R-1.IR_full       421 AGGAGCTAAGTGACGTGCGGGGGCTGCGGATGAGTGCCAGCCAGGATGATGGCAAGTCTG 480
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
1324R-1.in silico     421 AGGAGCTAAGTGACGTGCGGGGGCTGCGGATGAGTGCCAGCCAGGATGATGGCAAGTCTG 480


1324R-1.IR_full       481 GTAATTTCGAGCAGCCAGAA 500
                          ||||||||||||||||||||
1324R-1.in silico     481 GTAATTTCGAGCAGCCAGAA 500

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   481  NM_134562.2  CG1324-RA (CG1324), mRNA 
0.62   NM_143320.2  CG18437-RA (CG18437), mRNA 
0.41   NM_143508.1  CG7928-RA (CG7928), mRNA 
0.2   NM_079079.2  CG9709-RA (Acox57D-d), mRNA 
0.2   NM_078775.2  CG13780-RA (Pvf2), mRNA 
0   21  NM_167340.1  CG32648-RA (Pde9), mRNA 
0   NM_130505.2  CG13359-RA (CG13359), mRNA 
0   NM_080317.2  CG2647-RA (per), mRNA 
0   12  NM_139725.2  CG5249-RA (Blimp-1), mRNA 
0   NM_166957.1  CG32793-RA (CG32793), mRNA 
0   16  NM_080025.1  CG11387-RA, transcript variant A (ct), mRNA 
0   13  NM_167130.1  CG11387-RB, transcript variant B (ct), mRNA 
0   NM_139976.1  CG6765-RA (CG6765), mRNA 
0   NM_139488.2  CG1240-RA (CG1240), mRNA 
0   NM_137256.1  CG15701-RA (CG15701), mRNA 
0   NM_143452.1  CG1911-RA (CAP-D2), mRNA 
0   NM_132239.1  CG1632-RA (CG1632), mRNA 
0   NM_135310.2  CG7115-RB, transcript variant B (CG7115), mRNA 
0   NM_164774.1  CG7115-RA, transcript variant A (CG7115), mRNA 
0   NM_169500.1  CG8630-RA (CG8630), mRNA 
0   NM_079706.2  CG3412-RA (slmb), mRNA 
0   NM_138247.1  CG9134-RB, transcript variant B (CG9134), mRNA 
0   NM_080118.2  CG2075-RA (aly), mRNA 
0   NM_001042909.1  CG31619-RC, transcript variant C (CG31619), mRNA 
0   NM_165396.1  CG31619-RA, transcript variant A (CG31619), mRNA 
0   NM_079001.2  CG3886-RA (Psc), mRNA 
0   NM_165397.1  CG31619-RB, transcript variant B (CG31619), mRNA 
0   10  NM_078816.2  CG7279-RA (Lip1), mRNA 
0   NM_078667.2  CG6474-RA (e(y)1), mRNA 
0   NM_139450.2  CG5714-RA (ecd), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.