National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 13243R-4 
 Symbol CG13243  Full Name CG13243 
 CG No CG13243  Old CG No CG13243 
 Synonyms BG:DS02252.1, CG13243 
 Accession No (Link to NCBI) NM_135925.2 
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees viable 
 Map Viewer
[Please submit your publication]
Rauskolb C, Pan G, Reddy BV, Oh H, Irvine KD.
Zyxin links fat signaling to the hippo pathway.
PLoS Biol (2011) 9(6) e1000624 [ PubMed ID = 21666802 ] [ RRC reference ]

Umemori M, Habara O, Iwata T, Maeda K, Nishinoue K, Okabe A, Takemura M, Takahashi K, Saigo K, Ueda R, Adachi-Yamada T.
RNAi-mediated knockdown showing impaired cell survival in Drosophila wing imaginal disc.
Gene Regul Syst Bio (2009) 3 11-20 [ PubMed ID = 19838331 ] [ RRC reference ]  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
 Primer Seq. 3'
 Predicted Fragment Size
 IR fragment full Seq
 in silico PCR Fragment
 Assemble Data

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     1   TGTGACCTGTGACATGGAGCAGTTTCGCGATCCAAACAAGAAGCGTGCCGCCAACGATGC 60

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     61  CTGCGAGGAGCTGGACAAGCTGGATGCCCAGGACGAGATCAGTGTGTCGAGTATCATTTC 120

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     121 GGCGCTATTGAGACCGATTGAGCCCTCGGACGATCAGTACAAGGTGTGCGACTGGGGCAT 180

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     181 CAATCCCAAGCAGTTTATGCCCACCAAACAGGCGATCATTTTCAAGGAACAGTTGTTCAT 240

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     241 ATCGAAGTTGCGGAATACAAATTGCAAGCTAAATGAAAATCTAAAAATCTTCTTTGAGCG 300

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     301 GGAACTTGAGCAGATTGGACGCTTCTGTTTGAATGTGGAGGAATCCTTTGATGGCTATGT 360

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     361 GATCTTCAGCAGCAGCAAAATGAAGAAGGGCAAGGGTATGACGGAATGTGGTCACCAGTT 420

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     421 AAAGGGGAAGTACGATGACAAGTTCCTTCTCATCTGCGAGAAGAGATCGGAGTTCGACCG 480

13243R-4.IR_full       481 AATCGACAATACTCGGGTAG 500
                           |||||||||||||||||||| silico     481 AATCGACAATACTCGGGTAG 500

 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_135925.2  CG13243-RA (CG13243), mRNA 
0.2   NM_167637.1  CG32544-RA (CG32544), mRNA 
0   10  NM_170379.2  CG31048-RA (CG31048), mRNA 
0   NM_165479.1  CG15845-RA, transcript variant A (Adf1), mRNA 
0   NM_206028.1  CG15845-RC, transcript variant C (Adf1), mRNA 
0   NM_165480.1  CG15845-RB, transcript variant B (Adf1), mRNA 
0   NM_139632.1  CG1319-RA (CG1319), mRNA 
0   NM_138047.2  CG4065-RA, transcript variant A (CG4065), mRNA 
0   NM_001014546.1  CG4065-RB, transcript variant B (CG4065), mRNA 
0   NM_143492.2  CG15522-RA (CG15522), mRNA 
0   NM_140291.1  CG17152-RA (CG17152), mRNA 
0   NM_132375.1  CG2972-RA (CG2972), mRNA 
0   NM_135005.1  CG11929-RA (CG11929), mRNA 
0   NM_001031870.1  CG15892-RA, transcript variant A (CG15892), mRNA 
0   NM_001031869.1  CG15892-RB, transcript variant B (CG15892), mRNA 
0   NM_167069.1  CG15891-RA, transcript variant A (CG15891), mRNA 
0   NM_206435.1  CG33324-RA (CG33324), mRNA 
0   14  NM_079919.2  CG5700-RB (prc), mRNA 
0   NM_132009.2  CG11473-RA (CG11473), mRNA 
0   NM_001038909.1  CG33205-RI, transcript variant I (CG33205), mRNA 
0   NM_139819.2  CG8638-RA (CG8638), mRNA 
0   NM_166874.1  CG3638-RA, transcript variant A (CG3638), mRNA 
0   NM_130541.3  CG3638-RC, transcript variant C (CG3638), mRNA 
0   NM_166872.1  CG3638-RD, transcript variant D (CG3638), mRNA 
0   NM_166873.1  CG3638-RB, transcript variant B (CG3638), mRNA 
0   NM_078866.2  CG6549-RA, transcript variant A (fws), mRNA 
0   NM_165221.1  CG6549-RC, transcript variant C (fws), mRNA 
0   NM_057262.2  CG1828-RA, transcript variant A (dre4), mRNA 
0   NM_167922.1  CG1828-RB, transcript variant B (dre4), mRNA 
0   NM_136727.2  CG18408-RA, transcript variant A (CAP), mRNA 
 Wing Disc
JNK signal
Caspase-3 signal
Dcompartment   Penetrance

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.