National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock discarded request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 13243R-1 
 Symbol CG13243  Full Name CG13243 
 CG No CG13243  Old CG No CG13243 
 Synonyms BG:DS02252.1, CG13243 
 Accession No (Link to NCBI) NM_135925.2 
 Inserted Chr. ll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees viable 
 Map Viewer
 Reference
[Please submit your publication]
Rauskolb C, Pan G, Reddy BV, Oh H, Irvine KD.
Zyxin links fat signaling to the hippo pathway.
PLoS Biol (2011) 9(6) e1000624 [ PubMed ID = 21666802 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgTGTGACCTGTGACATGGAGCA 
 Primer Seq. 3'
aatctagaggtaccCTACCCGAGTATTGTCGATTC 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 TGTGACCTGT GACATGGAGC AGTTTCGCGA TCCAAACAAG AAGCGTGCCG CCAACGATGC 
0061 CTGCGAGGAG CTGGACAAGC TGGATGCCCA GGACGAGATC AGTGTGTCGA GTATCATTTC 
0121 GGCGCTATTG AGACCGATTG AGCCCTCGGA CGATCAGTAC AAGGTGTGCG ACTGGGGCAT 
0181 CAATCCCAAG CAGTTTATGC CCACCAAACA GGCGATCATT TTCAAGGAAC AGTTGTTCAT 
0241 ATCGAAGTTG CGGAATACAA ATTGCAAGCT AAATGAAAAT CTAAAAATCT TCTTTGAGCG 
0301 GGAACTTGAG CAGATTGGAC GCTTCTGTTT GAATGTGGAG GAATCCTTTG ATGGCTATGT 
0361 GATCTTCAGC AGCAGCAAAA TGAAGAAGGG CAAGGGTATG ACGGAATGTG GTCACCAGTT 
0421 AAAGGGGAAG TACGATGACA AGTTCCTTCT CATCTGCGAG AAGAGATCGG AGTTCGACCG 
0481 AATCGACAAT ACTCGGGTAG  
 in silico PCR Fragment
0001 TGTGACCTGT GACATGGAGC AGTTTCGCGA TCCAAACAAG AAGCGTGCCG CCAACGATGC 
0061 CTGCGAGGAG CTGGACAAGC TGGATGCCCA GGACGAGATC AGTGTGTCGA GTATCATTTC 
0121 GGCGCTATTG AGACCGATTG AGCCCTCGGA CGATCAGTAC AAGGTGTGCG ACTGGGGCAT 
0181 CAATCCCAAG CAGTTTATGC CCACCAAACA GGCGATCATT TTCAAGGAAC AGTTGTTCAT 
0241 ATCGAAGTTG CGGAATACAA ATTGCAAGCT AAATGAAAAT CTAAAAATCT TCTTTGAGCG 
0301 GGAACTTGAG CAGATTGGAC GCTTCTGTTT GAATGTGGAG GAATCCTTTG ATGGCTATGT 
0361 GATCTTCAGC AGCAGCAAAA TGAAGAAGGG CAAGGGTATG ACGGAATGTG GTCACCAGTT 
0421 AAAGGGGAAG TACGATGACA AGTTCCTTCT CATCTGCGAG AAGAGATCGG AGTTCGACCG 
0481 AATCGACAAT ACTCGGGTAG  
 Assemble Data

13243R-1.IR_full       1   TGTGACCTGTGACATGGAGCAGTTTCGCGATCCAAACAAGAAGCGTGCCGCCAACGATGC 60
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
13243R-1.in silico     1   TGTGACCTGTGACATGGAGCAGTTTCGCGATCCAAACAAGAAGCGTGCCGCCAACGATGC 60


13243R-1.IR_full       61  CTGCGAGGAGCTGGACAAGCTGGATGCCCAGGACGAGATCAGTGTGTCGAGTATCATTTC 120
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
13243R-1.in silico     61  CTGCGAGGAGCTGGACAAGCTGGATGCCCAGGACGAGATCAGTGTGTCGAGTATCATTTC 120


13243R-1.IR_full       121 GGCGCTATTGAGACCGATTGAGCCCTCGGACGATCAGTACAAGGTGTGCGACTGGGGCAT 180
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
13243R-1.in silico     121 GGCGCTATTGAGACCGATTGAGCCCTCGGACGATCAGTACAAGGTGTGCGACTGGGGCAT 180


13243R-1.IR_full       181 CAATCCCAAGCAGTTTATGCCCACCAAACAGGCGATCATTTTCAAGGAACAGTTGTTCAT 240
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
13243R-1.in silico     181 CAATCCCAAGCAGTTTATGCCCACCAAACAGGCGATCATTTTCAAGGAACAGTTGTTCAT 240


13243R-1.IR_full       241 ATCGAAGTTGCGGAATACAAATTGCAAGCTAAATGAAAATCTAAAAATCTTCTTTGAGCG 300
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
13243R-1.in silico     241 ATCGAAGTTGCGGAATACAAATTGCAAGCTAAATGAAAATCTAAAAATCTTCTTTGAGCG 300


13243R-1.IR_full       301 GGAACTTGAGCAGATTGGACGCTTCTGTTTGAATGTGGAGGAATCCTTTGATGGCTATGT 360
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
13243R-1.in silico     301 GGAACTTGAGCAGATTGGACGCTTCTGTTTGAATGTGGAGGAATCCTTTGATGGCTATGT 360


13243R-1.IR_full       361 GATCTTCAGCAGCAGCAAAATGAAGAAGGGCAAGGGTATGACGGAATGTGGTCACCAGTT 420
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
13243R-1.in silico     361 GATCTTCAGCAGCAGCAAAATGAAGAAGGGCAAGGGTATGACGGAATGTGGTCACCAGTT 420


13243R-1.IR_full       421 AAAGGGGAAGTACGATGACAAGTTCCTTCTCATCTGCGAGAAGAGATCGGAGTTCGACCG 480
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
13243R-1.in silico     421 AAAGGGGAAGTACGATGACAAGTTCCTTCTCATCTGCGAGAAGAGATCGGAGTTCGACCG 480


13243R-1.IR_full       481 AATCGACAATACTCGGGTAG 500
                           ||||||||||||||||||||
13243R-1.in silico     481 AATCGACAATACTCGGGTAG 500

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_135925.2  CG13243-RA (CG13243), mRNA 
0.2   NM_167637.1  CG32544-RA (CG32544), mRNA 
0   10  NM_170379.2  CG31048-RA (CG31048), mRNA 
0   NM_165479.1  CG15845-RA, transcript variant A (Adf1), mRNA 
0   NM_206028.1  CG15845-RC, transcript variant C (Adf1), mRNA 
0   NM_165480.1  CG15845-RB, transcript variant B (Adf1), mRNA 
0   NM_139632.1  CG1319-RA (CG1319), mRNA 
0   NM_138047.2  CG4065-RA, transcript variant A (CG4065), mRNA 
0   NM_001014546.1  CG4065-RB, transcript variant B (CG4065), mRNA 
0   NM_143492.2  CG15522-RA (CG15522), mRNA 
0   NM_140291.1  CG17152-RA (CG17152), mRNA 
0   NM_132375.1  CG2972-RA (CG2972), mRNA 
0   NM_135005.1  CG11929-RA (CG11929), mRNA 
0   NM_001031870.1  CG15892-RA, transcript variant A (CG15892), mRNA 
0   NM_001031869.1  CG15892-RB, transcript variant B (CG15892), mRNA 
0   NM_167069.1  CG15891-RA, transcript variant A (CG15891), mRNA 
0   NM_206435.1  CG33324-RA (CG33324), mRNA 
0   14  NM_079919.2  CG5700-RB (prc), mRNA 
0   NM_132009.2  CG11473-RA (CG11473), mRNA 
0   NM_001038909.1  CG33205-RI, transcript variant I (CG33205), mRNA 
0   NM_139819.2  CG8638-RA (CG8638), mRNA 
0   NM_166874.1  CG3638-RA, transcript variant A (CG3638), mRNA 
0   NM_130541.3  CG3638-RC, transcript variant C (CG3638), mRNA 
0   NM_166872.1  CG3638-RD, transcript variant D (CG3638), mRNA 
0   NM_166873.1  CG3638-RB, transcript variant B (CG3638), mRNA 
0   NM_078866.2  CG6549-RA, transcript variant A (fws), mRNA 
0   NM_165221.1  CG6549-RC, transcript variant C (fws), mRNA 
0   NM_057262.2  CG1828-RA, transcript variant A (dre4), mRNA 
0   NM_167922.1  CG1828-RB, transcript variant B (dre4), mRNA 
0   NM_136727.2  CG18408-RA, transcript variant A (CAP), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.