National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 13240R-2 
 Symbol l(2)35Di  Full Name lethal (2) 35Di 
 CG No CG13240  Old CG No CG13240 
 Synonyms BG:DS09217.1, CG13240, BcDNA:GM23292, l(2)35Di 
 Accession No (Link to NCBI) NM_135921.2 
 Inserted Chr. ll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
 Reference
[Please submit your publication]
Garcia CJ, Khajeh J, Coulanges E, Chen EI, Owusu-Ansah E.
Regulation of Mitochondrial Complex I Biogenesis in Drosophila Flight Muscles.
Cell Rep (2017) 20(1) 264-278 [ PubMed ID = 28683319 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgATGGTAGCTGGTGGTGCCTCG 
 Primer Seq. 3'
aatctagaggtaccGCTTTCAGCGGCGACTCGTTG 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 ATGGTAGCTG GTGGTGCCTC GGAAACGGGC GGCGTGAAGC CGATGGTAAT TGCGGGCCGC 
0061 ATGGTGCGGG AGCGTGAGCG cCTGATCGGC ATGTCGCCGG AGGAGCGCGC CTGGCGCAAA 
0121 CAGTGGCTGA AGGACCAGGA GCTGCACCAT GGACCCCGCA AGGTGCCCGC CCTGGAGCTG 
0181 GAGCTGAACA ACCCCATCAA GCGCTTCTAC CGCGCTCCCC TCGACAAGGT CTGCAATGTT 
0241 TTGGAACCCG TCCTGGGCTT TCAGCGCGCG TACACCGTGC GCTTCTGGAC CGGAAAGGCT 
0301 CTGCTCGCCC TAACCGGAAT CTACGCCGGC GCCTACTACT TCAAGTACAA TCAGAATGAC 
0361 TGGACCCGGA AGGGCGGCTG GCGTGTGATC CACTCGCGCA AGCAGTGCGT GCCCGGAGAT 
0421 GAGGGCTATC CCAAGGTCTC CGATCGATCG GCGCCTTCCG ATTACGCGGC TCGCGGATTC 
0481 AACGAGTCGC CGCTGAAACT ACCCTCTAGA GGH 
 in silico PCR Fragment
0001 ATGGTAGCTG GTGGTGCCTC GGAAACGGGC GGCGTGAAGC CGATGGTAAT TGCGGGCCGC 
0061 ATGGTGCGGG AGCGTGAGCG CCTGATCGGC ATGTCGCCGG AGGAGCGCGC CTGGCGCAAA 
0121 CAGTGGCTGA AGGACCAGGA GCTGCACCAT GGACCCCGCA AGGTGCCCGC CCTGGAGCTG 
0181 GAGCTGAACA ACCCCATCAA GCGCTTCTAC CGCGCTCCCC TCGACAAGGT CTGCAATGTT 
0241 TTGGAACCCG TCCTGGGCTT TCAGCGCGCG TACACCGTGC GCTTCTGGAC CGGAAAGGCT 
0301 CTGCTCGCCC TAACCGGAAT CTACGCCGGC GCCTACTACT TCAAGTACAA CCAGAATGAC 
0361 TGGACCCGGA AGGGCGGCTG GCGTGTGATT CACTCGCGCA AGCAGTGCGT GCCCGGAGAT 
0421 GAGGGCTATC CCAAGGTCTC CGATCGATCG GCGCCTTCCG ATTACGCGGC TCGCGGATTC 
0481 AACGAGTCGC CGCTGAAA-- ---------- -GC 
 Assemble Data

13240R-2.IR_full       1   ATGGTAGCTGGTGGTGCCTCGGAAACGGGCGGCGTGAAGCCGATGGTAATTGCGGGCCGC 60
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
13240R-2.in silico     1   ATGGTAGCTGGTGGTGCCTCGGAAACGGGCGGCGTGAAGCCGATGGTAATTGCGGGCCGC 60


13240R-2.IR_full       61  ATGGTGCGGGAGCGTGAGCGCCTGATCGGCATGTCGCCGGAGGAGCGCGCCTGGCGCAAA 120
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
13240R-2.in silico     61  ATGGTGCGGGAGCGTGAGCGCCTGATCGGCATGTCGCCGGAGGAGCGCGCCTGGCGCAAA 120


13240R-2.IR_full       121 CAGTGGCTGAAGGACCAGGAGCTGCACCATGGACCCCGCAAGGTGCCCGCCCTGGAGCTG 180
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
13240R-2.in silico     121 CAGTGGCTGAAGGACCAGGAGCTGCACCATGGACCCCGCAAGGTGCCCGCCCTGGAGCTG 180


13240R-2.IR_full       181 GAGCTGAACAACCCCATCAAGCGCTTCTACCGCGCTCCCCTCGACAAGGTCTGCAATGTT 240
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
13240R-2.in silico     181 GAGCTGAACAACCCCATCAAGCGCTTCTACCGCGCTCCCCTCGACAAGGTCTGCAATGTT 240


13240R-2.IR_full       241 TTGGAACCCGTCCTGGGCTTTCAGCGCGCGTACACCGTGCGCTTCTGGACCGGAAAGGCT 300
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
13240R-2.in silico     241 TTGGAACCCGTCCTGGGCTTTCAGCGCGCGTACACCGTGCGCTTCTGGACCGGAAAGGCT 300


13240R-2.IR_full       301 CTGCTCGCCCTAACCGGAATCTACGCCGGCGCCTACTACTTCAAGTACAATCAGAATGAC 360
                           |||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||
13240R-2.in silico     301 CTGCTCGCCCTAACCGGAATCTACGCCGGCGCCTACTACTTCAAGTACAACCAGAATGAC 360


13240R-2.IR_full       361 TGGACCCGGAAGGGCGGCTGGCGTGTGATCCACTCGCGCAAGCAGTGCGTGCCCGGAGAT 420
                           ||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||
13240R-2.in silico     361 TGGACCCGGAAGGGCGGCTGGCGTGTGATTCACTCGCGCAAGCAGTGCGTGCCCGGAGAT 420


13240R-2.IR_full       421 GAGGGCTATCCCAAGGTCTCCGATCGATCGGCGCCTTCCGATTACGCGGCTCGCGGATTC 480
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
13240R-2.in silico     421 GAGGGCTATCCCAAGGTCTCCGATCGATCGGCGCCTTCCGATTACGCGGCTCGCGGATTC 480


13240R-2.IR_full       481 AACGAGTCGCCGCTGAAACTACCCTCTAGAGGH 513
                           ||||||||||||||||||             | 
13240R-2.in silico     481 AACGAGTCGCCGCTGAAA-------------GC 513

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_135921.2  CG13240-RA, transcript variant A (l(2)35Di), mRNA 
70.53   340  NM_165126.1  CG13240-RB, transcript variant B (l(2)35Di), mRNA 
0   NM_206504.1  CG31190-RB, transcript variant B (CG31190), mRNA 
0   NM_169761.1  CG31190-RA, transcript variant A (CG31190), mRNA 
0   NM_130596.2  CG14804-RA (CG14804), mRNA 
0   NM_165770.1  CG11763-RA, transcript variant A (micr), mRNA 
0   NM_001038849.1  CG11763-RD, transcript variant D (micr), mRNA 
0   NM_136741.2  CG11763-RC, transcript variant C (micr), mRNA 
0   NM_166004.1  CG6145-RB, transcript variant B (CG6145), mRNA 
0   NM_166003.1  CG6145-RC, transcript variant C (CG6145), mRNA 
0   NM_137040.2  CG6145-RA, transcript variant A (CG6145), mRNA 
0   NM_167081.2  CG4094-RB, transcript variant B (l(1)G0255), mRNA 
0   NM_132111.2  CG4094-RA, transcript variant A (l(1)G0255), mRNA 
0   NM_137385.1  CG18432-RA (CG18432), mRNA 
0   NM_141178.3  CG12581-RA, transcript variant A (CG12581), mRNA 
0   NM_164313.1  CG12581-RB, transcript variant B (CG12581), mRNA 
0   NM_079155.2  CG9102-RA (bab2), mRNA 
0   NM_134544.1  CG11734-RB (HERC2), mRNA 
0   NM_140772.2  CG7341-RA, transcript variant A (CG7341), mRNA 
0   NM_168763.1  CG7341-RB, transcript variant B (CG7341), mRNA 
0   NM_141736.1  CG11872-RA (CG11872), mRNA 
0   NM_001038787.1  CG33995-RC, transcript variant C (CG33995), mRNA 
0   NM_135056.3  CG31919-RC, transcript variant C (CG31919), mRNA 
0   NM_001038788.1  CG33995-RA, transcript variant A (CG33995), mRNA 
0   NM_164622.2  CG31919-RB, transcript variant B (CG31919), mRNA 
0   NM_001038786.1  CG33995-RB, transcript variant B (CG33995), mRNA 
0   NM_164623.1  CG31919-RD, transcript variant D (CG31919), mRNA 
0   NM_001038785.1  CG31919-RE, transcript variant E (CG31919), mRNA 
0   NM_140189.1  CG7616-RA (CG7616), mRNA 
0   NM_132867.1  CG9170-RA, transcript variant A (CG9170), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.