National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock discarded request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 13240R-1 
 Symbol l(2)35Di  Full Name lethal (2) 35Di 
 CG No CG13240  Old CG No CG13240 
 Synonyms BG:DS09217.1, CG13240, BcDNA:GM23292, l(2)35Di 
 Accession No (Link to NCBI) NM_135921.2 
 Inserted Chr. ll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees viable 
 Map Viewer
[Please submit your publication]
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
 Primer Seq. 3'
 Predicted Fragment Size
 IR fragment full Seq
 in silico PCR Fragment
0481 AACGAGTCGC CGCTGAAA-- ---------- -GC 
 Assemble Data

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     1   ATGGTAGCTGGTGGTGCCTCGGAAACGGGCGGCGTGAAGCCGATGGTAATTGCGGGCCGC 60

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     61  ATGGTGCGGGAGCGTGAGCGCCTGATCGGCATGTCGCCGGAGGAGCGCGCCTGGCGCAAA 120

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     121 CAGTGGCTGAAGGACCAGGAGCTGCACCATGGACCCCGCAAGGTGCCCGCCCTGGAGCTG 180

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     181 GAGCTGAACAACCCCATCAAGCGCTTCTACCGCGCTCCCCTCGACAAGGTCTGCAATGTT 240

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     241 TTGGAACCCGTCCTGGGCTTTCAGCGCGCGTACACCGTGCGCTTCTGGACCGGAAAGGCT 300

                           |||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| silico     301 CTGCTCGCCCTAACCGGAATCTACGCCGGCGCCTACTACTTCAAGTACAACCAGAATGAC 360

                           ||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| silico     361 TGGACCCGGAAGGGCGGCTGGCGTGTGATTCACTCGCGCAAGCAGTGCGTGCCCGGAGAT 420

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     421 GAGGGCTATCCCAAGGTCTCCGATCGATCGGCGCCTTCCGATTACGCGGCTCGCGGATTC 480

                           ||||||||||||||||||             | silico     481 AACGAGTCGCCGCTGAAA-------------GC 513

 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_135921.2  CG13240-RA, transcript variant A (l(2)35Di), mRNA 
70.53   340  NM_165126.1  CG13240-RB, transcript variant B (l(2)35Di), mRNA 
0   NM_206504.1  CG31190-RB, transcript variant B (CG31190), mRNA 
0   NM_169761.1  CG31190-RA, transcript variant A (CG31190), mRNA 
0   NM_130596.2  CG14804-RA (CG14804), mRNA 
0   NM_165770.1  CG11763-RA, transcript variant A (micr), mRNA 
0   NM_001038849.1  CG11763-RD, transcript variant D (micr), mRNA 
0   NM_136741.2  CG11763-RC, transcript variant C (micr), mRNA 
0   NM_166004.1  CG6145-RB, transcript variant B (CG6145), mRNA 
0   NM_166003.1  CG6145-RC, transcript variant C (CG6145), mRNA 
0   NM_137040.2  CG6145-RA, transcript variant A (CG6145), mRNA 
0   NM_167081.2  CG4094-RB, transcript variant B (l(1)G0255), mRNA 
0   NM_132111.2  CG4094-RA, transcript variant A (l(1)G0255), mRNA 
0   NM_137385.1  CG18432-RA (CG18432), mRNA 
0   NM_141178.3  CG12581-RA, transcript variant A (CG12581), mRNA 
0   NM_164313.1  CG12581-RB, transcript variant B (CG12581), mRNA 
0   NM_079155.2  CG9102-RA (bab2), mRNA 
0   NM_134544.1  CG11734-RB (HERC2), mRNA 
0   NM_140772.2  CG7341-RA, transcript variant A (CG7341), mRNA 
0   NM_168763.1  CG7341-RB, transcript variant B (CG7341), mRNA 
0   NM_141736.1  CG11872-RA (CG11872), mRNA 
0   NM_001038787.1  CG33995-RC, transcript variant C (CG33995), mRNA 
0   NM_135056.3  CG31919-RC, transcript variant C (CG31919), mRNA 
0   NM_001038788.1  CG33995-RA, transcript variant A (CG33995), mRNA 
0   NM_164622.2  CG31919-RB, transcript variant B (CG31919), mRNA 
0   NM_001038786.1  CG33995-RB, transcript variant B (CG33995), mRNA 
0   NM_164623.1  CG31919-RD, transcript variant D (CG31919), mRNA 
0   NM_001038785.1  CG31919-RE, transcript variant E (CG31919), mRNA 
0   NM_140189.1  CG7616-RA (CG7616), mRNA 
0   NM_132867.1  CG9170-RA, transcript variant A (CG9170), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.