National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock discarded request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 1318R-3 
 Symbol Hexo1  Full Name Hexosaminidase 1 
 CG No CG1318  Old CG No CG1318 
 Synonyms HEX1, HEX 1, DmHex1, CG1318, Hexo1, HEXO1 
 Accession No (Link to NCBI)  
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees late pupal lethal 
 Map Viewer
 Reference
[Please submit your publication]
 
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgGCCCACAGCTCGGATGACTTG 
 Primer Seq. 3'
aatctagaggtaccGCTAGTGTCTCCAGGCCATGA 
 Predicted Fragment Size
500 
 IR fragment full Seq
 
 in silico PCR Fragment
 
 Assemble Data

1318R-3.IR full       1   CGGCCCACAGCTCGGATGACTTGGTTTACGGCTACGAGTGCCGCAGTGNCTACTGCCAGA 60
                            |||||||||||||||||||||||||||||||||||||||||||||| |||||||||||
1318R-3.in silico     1   --GCCCACAGCTCGGATGACTTGGTTTACGGCTACGAGTGCCGCAGTGGCTACTGCCAGA 60


1318R-3.IR full       61  AGGTGGAGCTCAGCGAGGAGAACTACGNCAAGGCCATCAGCCTGTCCGTGTGCCGGCTCT 120
                          |||| |||||||||||||||||||||| |||||||||||| ||| |||||||||||||||
1318R-3.in silico     61  AGGTAGAGCTCAGCGAGGAGAACTACGTCAAGGCCATCAGTCTGCCCGTGTGCCGGCTCT 120


1318R-3.IR full       121 TCTGCGGCAGCTCCATCGGCACCTTGTGGCCCAAACCGACGGGCACTGTGCGTCTGGACA 180
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
1318R-3.in silico     121 TCTGCGGCAGCTCCATCGGCACCTTGTGGCCCAAACCGACGGGCACTGTGCGTCTGGACA 180


1318R-3.IR full       181 CGTTGATGCGCCAAGTGGACATCTCCTTTATTGATTTCAATTTCAATGGAATTGCCCGCC 240
                          |||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||
1318R-3.in silico     181 CGTTGATGCGCCAAGTGGACATCTCCTTCATTGATTTCAATTTCAATGGAATTGCCCGCC 240


1318R-3.IR full       241 AGCAGAAGCTATGGCGAGCGGTTGAAGACCGTTTCATGAACATGCTCGAAGCCCAGATTC 300
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
1318R-3.in silico     241 AGCAGAAGCTATGGCGAGCGGTTGAAGACCGTTTCATGAACATGCTCGAAGCCCAGATTC 300


1318R-3.IR full       301 CGGATCGCAAGGTTCTGGCACGAGGTGGCTACCGTATGTCTGTGAACATCAATACTCCGG 360
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
1318R-3.in silico     301 CGGATCGCAAGGTTCTGGCACGAGGTGGCTACCGTATGTCTGTGAACATCAATACTCCGG 360


1318R-3.IR full       361 ATGAGCCGACTCCGGCCAGACTCACCCTGGATACGGATGAGAGCTATACGCTGGACATTG 420
                          |||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||
1318R-3.in silico     361 ATGAGCCGACACCGGCCAGACTCACCCTGGATACGGATGAGAGCTATACGCTGGACATTG 420


1318R-3.IR full       421 ATACGGATGCCTCGGGTCATGTCCTGGCCAACATAACCGCGTCCAACTTCTTTGGAGCCC 480
                          |||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||
1318R-3.in silico     421 ATACGGATGCCTCGGGTCATGTGCTGGCCAACATAACCGCGTCCAACTTCTTTGGAGCCC 480


1318R-3.IR full       481 GTCATGGCCTGGAGACACTA-- 502
                          ||||||||||||||||||||  
1318R-3.in silico     481 GTCATGGCCTGGAGACACTAGC 502

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100  482  NM_168076.1  Hexosaminidase 1 CG1318-RD, transcript variant D (Hexo1), mRNA 
100  482  NM_079200.4  Hexosaminidase 1 CG1318-RA, transcript variant A (Hexo1), mRNA 
100  482  NM_168075.1  Hexosaminidase 1 CG1318-RB, transcript variant B (Hexo1), mRNA 
NM_136861.2  S2P CG8988-RA (S2P), mRNA 
NM_134603.1  Pros45 CG1489-RA (Pros45), mRNA 
NM_140970.2  CG5199-RA (CG5199), mRNA 
NM_168491.1  Neurexin IV CG6827-RB, transcript variant B (Nrx-IV), mRNA 
NM_079310.2  Neurexin IV CG6827-RA, transcript variant A (Nrx-IV), mRNA 
NM_165802.1  CG30015-RA, transcript variant A (CG30015), mRNA 
NM_136777.2  CG30015-RB, transcript variant B (CG30015), mRNA 
NM_165017.1  POU domain protein 2 CG12287-RB, transcript variant B (pdm2), mRNA 
NM_141907.2  CG10014-RA (CG10014), mRNA 
NM_206119.1  charlatan CG11798-RB, transcript variant B (chn), mRNA 
NM_001043082.1  charlatan CG11798-RC, transcript variant C (chn), mRNA 
NM_137169.3  charlatan CG11798-RA, transcript variant A (chn), mRNA 
NM_078834.2  POU domain protein 2 CG12287-RA, transcript variant A (pdm2), mRNA 
NM_142989.3  Dis3 CG6413-RA (Dis3), mRNA 
NM_140909.1  schumacher-levy CG17736-RA (schuy), mRNA 
NM_135750.1  CG16800-RA (CG16800), mRNA 
NM_206494.1  Tropomyosin 1 CG4898-RL, transcript variant L (Tm1), mRNA 
NM_079636.2  Tropomyosin 1 CG4898-RA, transcript variant A (Tm1), mRNA 
NM_141090.2  CG7158-RA (CG7158), mRNA 
NM_169218.1  Dipeptidyl aminopeptidase III CG7415-RB, transcript variant B (DppIII), mRNA 
NM_169217.1  Dipeptidyl aminopeptidase III CG7415-RC, transcript variant C (DppIII), mRNA 
NM_139400.1  CG8001-RA (CG8001), mRNA 
NM_057757.3  cramped CG2714-RA, transcript variant A (crm), mRNA 
NM_166951.1  cramped CG2714-RB, transcript variant B (crm), mRNA 
NM_176104.1  CG33087-RC (CG33087), mRNA 
NM_057938.3  deep orange CG3093-RA (dor), mRNA 
NM_168497.1  CG32105-RB (CG32105), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.