National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 1318R-2 
 Symbol Hexo1  Full Name Hexosaminidase 1 
 CG No CG1318  Old CG No CG1318 
 Synonyms HEX1, HEX 1, DmHex1, CG1318, Hexo1, HEXO1 
 Accession No (Link to NCBI)  
 Inserted Chr. ll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees late pupal lethal 
 Map Viewer
 Reference
[Please submit your publication]
 
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgGCCCACAGCTCGGATGACTTG 
 Primer Seq. 3'
aatctagaggtaccGCTAGTGTCTCCAGGCCATGA 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 CGGCCCACAG CTCGGATGAC TTGGTTTACG GCTACGAGTG CCGCAGTGNC TACTGCCAGA 
0061 AGGTGGAGCT CAGCGAGGAG AACTACGNCA AGGCCATCAG CCTGTCCGTG TGCCGGCTCT 
0121 TCTGCGGCAG CTCCATCGGC ACCTTGTGGC CCAAACCGAC GGGCACTGTG CGTCTGGACA 
0181 CGTTGATGCG CCAAGTGGAC ATCTCCTTTA TTGATTTCAA TTTCAATGGA ATTGCCCGCC 
0241 AGCAGAAGCT ATGGCGAGCG GTTGAAGACC GTTTCATGAA CATGCTCGAA GCCCAGATTC 
0301 CGGATCGCAA GGTTCTGGCA CGAGGTGGCT ACCGTATGTC TGTGAACATC AATACTCCGG 
0361 ATGAGCCGAC TCCGGCCAGA CTCACCCTGG ATACGGATGA GAGCTATACG CTGGACATTG 
0421 ATACGGATGC CTCGGGTCAT GTCCTGGCCA ACATAACCGC GTCCAACTTC TTTGGAGCCC 
0481 GTCATGGCCT GGAGACACTA  
 in silico PCR Fragment
0001 gcccacagct cggatgactt ggtttacggc tacgagtgcc gcagtggcta ctgccagaag 
0061 gtagagctca gcgaggagaa ctacgtcaag gccatcagtc tgcccgtgtg ccggctcttc 
0121 tgcggcagct ccatcggcac cttgtggccc aaaccgacgg gcactgtgcg tctggacacg 
0181 ttgatgcgcc aagtggacat ctccttcatt gatttcaatt tcaatggaat tgcccgccag 
0241 cagaagctat ggcgagcggt tgaagaccgt ttcatgaaca tgctcgaagc ccagattccg 
0301 gatcgcaagg ttctggcacg aggtggctac cgtatgtctg tgaacatcaa tactccggat 
0361 gagccgacac cggccagact caccctggat acggatgaga gctatacgct ggacattgat 
0421 acggatgcct cgggtcatgt gctggccaac ataaccgcgt ccaacttctt tggagcccgt 
0481 catggcctgg agacactagc  
 Assemble Data

1318R-2.IR full       1   CGGCCCACAGCTCGGATGACTTGGTTTACGGCTACGAGTGCCGCAGTGNCTACTGCCAGA 60
                            |||||||||||||||||||||||||||||||||||||||||||||| |||||||||||
1318R-2.in silico     1   --GCCCACAGCTCGGATGACTTGGTTTACGGCTACGAGTGCCGCAGTGGCTACTGCCAGA 60


1318R-2.IR full       61  AGGTGGAGCTCAGCGAGGAGAACTACGNCAAGGCCATCAGCCTGTCCGTGTGCCGGCTCT 120
                          |||| |||||||||||||||||||||| |||||||||||| ||| |||||||||||||||
1318R-2.in silico     61  AGGTAGAGCTCAGCGAGGAGAACTACGTCAAGGCCATCAGTCTGCCCGTGTGCCGGCTCT 120


1318R-2.IR full       121 TCTGCGGCAGCTCCATCGGCACCTTGTGGCCCAAACCGACGGGCACTGTGCGTCTGGACA 180
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
1318R-2.in silico     121 TCTGCGGCAGCTCCATCGGCACCTTGTGGCCCAAACCGACGGGCACTGTGCGTCTGGACA 180


1318R-2.IR full       181 CGTTGATGCGCCAAGTGGACATCTCCTTTATTGATTTCAATTTCAATGGAATTGCCCGCC 240
                          |||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||
1318R-2.in silico     181 CGTTGATGCGCCAAGTGGACATCTCCTTCATTGATTTCAATTTCAATGGAATTGCCCGCC 240


1318R-2.IR full       241 AGCAGAAGCTATGGCGAGCGGTTGAAGACCGTTTCATGAACATGCTCGAAGCCCAGATTC 300
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
1318R-2.in silico     241 AGCAGAAGCTATGGCGAGCGGTTGAAGACCGTTTCATGAACATGCTCGAAGCCCAGATTC 300


1318R-2.IR full       301 CGGATCGCAAGGTTCTGGCACGAGGTGGCTACCGTATGTCTGTGAACATCAATACTCCGG 360
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
1318R-2.in silico     301 CGGATCGCAAGGTTCTGGCACGAGGTGGCTACCGTATGTCTGTGAACATCAATACTCCGG 360


1318R-2.IR full       361 ATGAGCCGACTCCGGCCAGACTCACCCTGGATACGGATGAGAGCTATACGCTGGACATTG 420
                          |||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||
1318R-2.in silico     361 ATGAGCCGACACCGGCCAGACTCACCCTGGATACGGATGAGAGCTATACGCTGGACATTG 420


1318R-2.IR full       421 ATACGGATGCCTCGGGTCATGTCCTGGCCAACATAACCGCGTCCAACTTCTTTGGAGCCC 480
                          |||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||
1318R-2.in silico     421 ATACGGATGCCTCGGGTCATGTGCTGGCCAACATAACCGCGTCCAACTTCTTTGGAGCCC 480


1318R-2.IR full       481 GTCATGGCCTGGAGACACTA-- 502
                          ||||||||||||||||||||  
1318R-2.in silico     481 GTCATGGCCTGGAGACACTAGC 502

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100  482  NM_168076.1  Hexosaminidase 1 CG1318-RD, transcript variant D (Hexo1), mRNA 
100  482  NM_079200.4  Hexosaminidase 1 CG1318-RA, transcript variant A (Hexo1), mRNA 
100  482  NM_168075.1  Hexosaminidase 1 CG1318-RB, transcript variant B (Hexo1), mRNA 
NM_136861.2  S2P CG8988-RA (S2P), mRNA 
NM_134603.1  Pros45 CG1489-RA (Pros45), mRNA 
NM_140970.2  CG5199-RA (CG5199), mRNA 
NM_168491.1  Neurexin IV CG6827-RB, transcript variant B (Nrx-IV), mRNA 
NM_079310.2  Neurexin IV CG6827-RA, transcript variant A (Nrx-IV), mRNA 
NM_165802.1  CG30015-RA, transcript variant A (CG30015), mRNA 
NM_136777.2  CG30015-RB, transcript variant B (CG30015), mRNA 
NM_165017.1  POU domain protein 2 CG12287-RB, transcript variant B (pdm2), mRNA 
NM_141907.2  CG10014-RA (CG10014), mRNA 
NM_206119.1  charlatan CG11798-RB, transcript variant B (chn), mRNA 
NM_001043082.1  charlatan CG11798-RC, transcript variant C (chn), mRNA 
NM_137169.3  charlatan CG11798-RA, transcript variant A (chn), mRNA 
NM_078834.2  POU domain protein 2 CG12287-RA, transcript variant A (pdm2), mRNA 
NM_142989.3  Dis3 CG6413-RA (Dis3), mRNA 
NM_140909.1  schumacher-levy CG17736-RA (schuy), mRNA 
NM_135750.1  CG16800-RA (CG16800), mRNA 
NM_206494.1  Tropomyosin 1 CG4898-RL, transcript variant L (Tm1), mRNA 
NM_079636.2  Tropomyosin 1 CG4898-RA, transcript variant A (Tm1), mRNA 
NM_141090.2  CG7158-RA (CG7158), mRNA 
NM_169218.1  Dipeptidyl aminopeptidase III CG7415-RB, transcript variant B (DppIII), mRNA 
NM_169217.1  Dipeptidyl aminopeptidase III CG7415-RC, transcript variant C (DppIII), mRNA 
NM_139400.1  CG8001-RA (CG8001), mRNA 
NM_057757.3  cramped CG2714-RA, transcript variant A (crm), mRNA 
NM_166951.1  cramped CG2714-RB, transcript variant B (crm), mRNA 
NM_176104.1  CG33087-RC (CG33087), mRNA 
NM_057938.3  deep orange CG3093-RA (dor), mRNA 
NM_168497.1  CG32105-RB (CG32105), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.