National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock discarded request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 1316R-3 
 Symbol CG1316  Full Name CG1316 
 CG No CG1316  Old CG No CG1316 
 Synonyms cg1316, CG1316 
 Accession No (Link to NCBI) NM_139630.1 
 Inserted Chr. lll 
 Insertional Mutation  lethal 
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
 Reference
[Please submit your publication]
 
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgAGGAGTACTCGAACGACGACG 
 Primer Seq. 3'
aatctagaggtaccGCAGTTTTCGAAAGCCACAGC 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 AGGAGTACTC GAACGACGAC GATCCGCCGA TGTCGCGTCT CTTCATCATT TGCAACAAGG 
0061 CGCACACCGA GGAGGATTTC CGTGAAGCCT TCTCGCCATA CGGCGAAATC GAGGATATCT 
0121 GGGTGGTGAA GGACAAGCAC ACCCAGGAGA ACAAGGGAAT CGCGTACGTC AAGTTCTCCA 
0181 AGACATCCGA TGCTGCCAAG GCACAGGAGG AGATGAACGG CAAGACCATT GGCAAGATGG 
0241 ATCGCACCCT TAAAGTCCTG GTGGCAGCCA ATCGCAATCA GGGCTCAAAT AAGTCTGAGA 
0301 ACGAGCAGGA GAAGTACGTG AGACTCTTCA TAGTGATCCC CAAAACAGCC ACCGAGGAGG 
0361 ATATTCGCGA GGAATTCTCG CAGTGGGGCG ATGTGGAATC TGTCACAATT GTCAAGGAGA 
0421 AGAACAATGG CAATNCCAAG GGCTTCGGAT ATGTCCGCTT TACCAAGTTT TACTATGCAG 
0481 CTGTGGCTTT CGAAAANTGC  
 in silico PCR Fragment
0001 AGGAGTACTC GAACGACGAC GATCCGCCGA TGTCGCGTCT CTTCATCATT TGCAACAAGG 
0061 CGCACACCGA GGAGGATTTC CGTGAAGCCT TCTCGCCATA CGGCGAAATC GAGGATATCT 
0121 GGGTGGTGAA GGACAAGCAC ACCCAGGAGA ACAAGGGAAT CGCGTACGTC AAGTTCTCCA 
0181 AGACATCCGA TGCTGCCAAG GCACAGGAGG AGATGAACGG CAAGACCATT GGCAAGATGG 
0241 ATCGCACCCT TAAAGTCCTG GTGGCAGCCA ATCGCAATCA GGGCTCAAAT AAGTCTGAGA 
0301 ACGAGCAGGA GAAGTACGTG AGACTCTTCA TAGTGATCCC CAAAACAGCC ACCGAGGAGG 
0361 ATATTCGCGA GGAATTCTCG CAGTGGGGCG ATGTGGAATC TGTCACAATT GTCAAGGAGA 
0421 AGAACAATGG CAATCCCAAG GGCTTCGGAT ATGTCCGCTT TACCAAGTTT TACTATGCAG 
0481 CTGTGGCTTT CGAAAACTGC  
 Assemble Data

1316R-3.IR_full       1   AGGAGTACTCGAACGACGACGATCCGCCGATGTCGCGTCTCTTCATCATTTGCAACAAGG 60
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
1316R-3.in silico     1   AGGAGTACTCGAACGACGACGATCCGCCGATGTCGCGTCTCTTCATCATTTGCAACAAGG 60


1316R-3.IR_full       61  CGCACACCGAGGAGGATTTCCGTGAAGCCTTCTCGCCATACGGCGAAATCGAGGATATCT 120
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
1316R-3.in silico     61  CGCACACCGAGGAGGATTTCCGTGAAGCCTTCTCGCCATACGGCGAAATCGAGGATATCT 120


1316R-3.IR_full       121 GGGTGGTGAAGGACAAGCACACCCAGGAGAACAAGGGAATCGCGTACGTCAAGTTCTCCA 180
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
1316R-3.in silico     121 GGGTGGTGAAGGACAAGCACACCCAGGAGAACAAGGGAATCGCGTACGTCAAGTTCTCCA 180


1316R-3.IR_full       181 AGACATCCGATGCTGCCAAGGCACAGGAGGAGATGAACGGCAAGACCATTGGCAAGATGG 240
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
1316R-3.in silico     181 AGACATCCGATGCTGCCAAGGCACAGGAGGAGATGAACGGCAAGACCATTGGCAAGATGG 240


1316R-3.IR_full       241 ATCGCACCCTTAAAGTCCTGGTGGCAGCCAATCGCAATCAGGGCTCAAATAAGTCTGAGA 300
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
1316R-3.in silico     241 ATCGCACCCTTAAAGTCCTGGTGGCAGCCAATCGCAATCAGGGCTCAAATAAGTCTGAGA 300


1316R-3.IR_full       301 ACGAGCAGGAGAAGTACGTGAGACTCTTCATAGTGATCCCCAAAACAGCCACCGAGGAGG 360
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
1316R-3.in silico     301 ACGAGCAGGAGAAGTACGTGAGACTCTTCATAGTGATCCCCAAAACAGCCACCGAGGAGG 360


1316R-3.IR_full       361 ATATTCGCGAGGAATTCTCGCAGTGGGGCGATGTGGAATCTGTCACAATTGTCAAGGAGA 420
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
1316R-3.in silico     361 ATATTCGCGAGGAATTCTCGCAGTGGGGCGATGTGGAATCTGTCACAATTGTCAAGGAGA 420


1316R-3.IR_full       421 AGAACAATGGCAATNCCAAGGGCTTCGGATATGTCCGCTTTACCAAGTTTTACTATGCAG 480
                          |||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||
1316R-3.in silico     421 AGAACAATGGCAATCCCAAGGGCTTCGGATATGTCCGCTTTACCAAGTTTTACTATGCAG 480


1316R-3.IR_full       481 CTGTGGCTTTCGAAAANTGC 500
                          |||||||||||||||| |||
1316R-3.in silico     481 CTGTGGCTTTCGAAAACTGC 500

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_139630.1  CG1316-RA (CG1316), mRNA 
0   NM_167257.1  CG1637-RA, transcript variant A (CG1637), mRNA 
0   NM_137736.1  CG15666-RA (CG15666), mRNA 
0   NM_170366.1  CG14066-RB, transcript variant B (larp), mRNA 
0   NM_080259.1  CG14066-RA, transcript variant A (larp), mRNA 
0   NM_170365.1  CG14066-RC, transcript variant C (larp), mRNA 
0   NM_139910.2  CG8209-RA (CG8209), mRNA 
0   NM_132317.1  CG12121-RA (CG12121), mRNA 
0   NM_057513.3  CG8153-RA, transcript variant A (mus210), mRNA 
0   NM_166087.1  CG8153-RC, transcript variant C (mus210), mRNA 
0   NM_167744.3  CG1693-RB, transcript variant B (tty), mRNA 
0   NM_080712.5  CG1693-RA, transcript variant A (tty), mRNA 
0   NM_140773.1  CG5137-RA (Cyp312a1), mRNA 
0   NM_057514.3  CG8153-RB, transcript variant B (mus210), mRNA 
0   NM_206507.1  CG7156-RB, transcript variant B (CG7156), mRNA 
0   NM_142440.2  CG7156-RA, transcript variant A (CG7156), mRNA 
0   NM_078983.2  CG8439-RA, transcript variant A (Cct5), mRNA 
0   NM_165867.1  CG8439-RB, transcript variant B (Cct5), mRNA 
0   NM_079808.2  CG5658-RA (Klp98A), mRNA 
0   NM_169249.1  CG31100-RA (CG31100), mRNA 
0   NM_176226.1  CG15086-RC, transcript variant C (CG15086), mRNA 
0   NM_176227.1  CG15086-RD, transcript variant D (CG15086), mRNA 
0   NM_176225.1  CG15086-RB, transcript variant B (CG15086), mRNA 
0   NM_137513.2  CG15086-RA, transcript variant A (CG15086), mRNA 
0   10  NM_170253.2  CG8318-RB, transcript variant B (Nf1), mRNA 
0   10  NM_170252.2  CG8318-RC, transcript variant C (Nf1), mRNA 
0   10  NM_001014668.1  CG8318-RD, transcript variant D (Nf1), mRNA 
0   NM_135123.2  CG9021-RA (CG9021), mRNA 
0   NM_143283.1  CG5882-RA (CG5882), mRNA 
0   NM_138269.1  CG12086-RA (cue), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.