National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock discarded request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 13167R-4 
 Symbol CG13167  Full Name CG13167 
 CG No CG13167  Old CG No CG13167 
 Synonyms CG13167 
 Accession No (Link to NCBI) NM_136909.2 
 Inserted Chr. lll 
 Insertional Mutation  lethal 
 Phenotype induced by Act5C-GAL4 at 28 degrees viable 
 Map Viewer
 Reference
[Please submit your publication]
 
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgATGGCCAAACGCGATATCCTG 
 Primer Seq. 3'
aatctagaggtaccATGTTGGTCTGCAACGAGGCT 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 ATGGCCAAAC GCGATATCCT GCCCATCTTT CCATCCCGCG CCAATTCGGT GATCATGAAG 
0061 CAGCGCGTNT TTGGCGGCTA GAAGGGGCGT GGGTCTCCTC AAGCGGAAgC GGGACGCCAT 
0121 CGATATGAAG CTACGCGAAT TGCGTCGCAT CCGCTTCGAC CAGGACATGC ACGGCGATGA 
0181 GGCGATGCGC AATGCCATAT TCTCGATGGC AAAGGCCAAT CTTCTGGGCG CCGATTTCAA 
0241 GCCGCAGATG GTAAGCCGCA GCCACGTGGC AACCGTATCG CTACGCCGCA CGGAGATCAA 
0301 AATTGTGGGC GTCAAGCTGA ACACCCTGGA GCTGGAGACG AAGGGCGTGG GCGCTTTTCC 
0361 GCTGGCTGGT CTCAGCTGTG GCGGTATGCA AGTGAGCCGA ATCAGGGACT CCTATACGAA 
0421 GGCACTCAAG GCACTGGTGG AGTTCGCCTC CCTGGAATAC CAAGTGCGAA TGCTGGAGGC 
0481 AGCCTCGTTG CAGACCAACA T 
 in silico PCR Fragment
0001 ATGGCCAAAC GCGATATCCT GCCCATCTTT CCATCCCGCG CCAATTCGGT GATCATGAAG 
0061 CAGCGCGT-T TTGGCGGCTA GAAGGGGCGT GGGTCTCCTC AAGCGGAAGC GGGACGCCAT 
0121 CGATATGAAG CTACGCGAAT TGCGTCGCAT CCGCTTCGAC CAGGACATGC ACGGCGATGA 
0181 GGCGATGCGC AATGCCATAT TCTCGATGGC AAAGGCCAAT CTTCTGGGCG CCGATTTCAA 
0241 GCCGCAGATG GTAAGCCGCA GCCACGTGGC AACCGTATCG CTACGCCGCA CGGAGATCAA 
0301 AATTGTGGGC GTCAAGCTGA ACACCCTGGA GCTGGAGACG AAGGGCGTGG GCGCTTTTCC 
0361 GCTGGCTGGT CTCAGCTGTG GCGGTATGCA AGTGAGCCGA ATCAGGGACT CCTATACGAA 
0421 GGCACTCAAG GCACTGGTGG AGTTCGCCTC TCTGGAATAC CAAGTGCGAA TGCTGGAGGC 
0481 AGCCTCGTTG CAGACCAACA T 
 Assemble Data

13167R-4.IR_full       1   ATGGCCAAACGCGATATCCTGCCCATCTTTCCATCCCGCGCCAATTCGGTGATCATGAAG 60
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
13167R-4.in silico     1   ATGGCCAAACGCGATATCCTGCCCATCTTTCCATCCCGCGCCAATTCGGTGATCATGAAG 60


13167R-4.IR_full       61  CAGCGCGTNTTTGGCGGCTAGAAGGGGCGTGGGTCTCCTCAAGCGGAAGCGGGACGCCAT 120
                           |||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||
13167R-4.in silico     61  CAGCGCGT-TTTGGCGGCTAGAAGGGGCGTGGGTCTCCTCAAGCGGAAGCGGGACGCCAT 120


13167R-4.IR_full       121 CGATATGAAGCTACGCGAATTGCGTCGCATCCGCTTCGACCAGGACATGCACGGCGATGA 180
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
13167R-4.in silico     121 CGATATGAAGCTACGCGAATTGCGTCGCATCCGCTTCGACCAGGACATGCACGGCGATGA 180


13167R-4.IR_full       181 GGCGATGCGCAATGCCATATTCTCGATGGCAAAGGCCAATCTTCTGGGCGCCGATTTCAA 240
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
13167R-4.in silico     181 GGCGATGCGCAATGCCATATTCTCGATGGCAAAGGCCAATCTTCTGGGCGCCGATTTCAA 240


13167R-4.IR_full       241 GCCGCAGATGGTAAGCCGCAGCCACGTGGCAACCGTATCGCTACGCCGCACGGAGATCAA 300
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
13167R-4.in silico     241 GCCGCAGATGGTAAGCCGCAGCCACGTGGCAACCGTATCGCTACGCCGCACGGAGATCAA 300


13167R-4.IR_full       301 AATTGTGGGCGTCAAGCTGAACACCCTGGAGCTGGAGACGAAGGGCGTGGGCGCTTTTCC 360
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
13167R-4.in silico     301 AATTGTGGGCGTCAAGCTGAACACCCTGGAGCTGGAGACGAAGGGCGTGGGCGCTTTTCC 360


13167R-4.IR_full       361 GCTGGCTGGTCTCAGCTGTGGCGGTATGCAAGTGAGCCGAATCAGGGACTCCTATACGAA 420
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
13167R-4.in silico     361 GCTGGCTGGTCTCAGCTGTGGCGGTATGCAAGTGAGCCGAATCAGGGACTCCTATACGAA 420


13167R-4.IR_full       421 GGCACTCAAGGCACTGGTGGAGTTCGCCTCCCTGGAATACCAAGTGCGAATGCTGGAGGC 480
                           |||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||
13167R-4.in silico     421 GGCACTCAAGGCACTGGTGGAGTTCGCCTCTCTGGAATACCAAGTGCGAATGCTGGAGGC 480


13167R-4.IR_full       481 AGCCTCGTTGCAGACCAACAT 501
                           |||||||||||||||||||||
13167R-4.in silico     481 AGCCTCGTTGCAGACCAACAT 501

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_136909.2  CG13167-RA (CG13167), mRNA 
0.41   NM_166698.1  CG30427-RA, transcript variant A (CG30427), mRNA 
0.41   NM_166699.1  CG30427-RD, transcript variant D (CG30427), mRNA 
0.41   NM_166697.1  CG30427-RC, transcript variant C (CG30427), mRNA 
0.41   NM_138136.2  CG30427-RB, transcript variant B (CG30427), mRNA 
0   NM_170326.2  CG31068-RA (CG31068), mRNA 
0   NM_136386.2  CG3409-RA (CG3409), mRNA 
0   NM_165219.1  CG6667-RC, transcript variant C (dl), mRNA 
0   NM_001038897.1  CG33971-RA (CG33971), mRNA 
0   NM_143313.1  CG5639-RA (CG5639), mRNA 
0   NM_169867.1  CG16718-RB, transcript variant B (CG16718), mRNA 
0   NM_142563.1  CG16718-RA, transcript variant A (CG16718), mRNA 
0   NM_168497.1  CG32105-RB (CG32105), mRNA 
0   NM_167152.1  CG2286-RB, transcript variant B (ND75), mRNA 
0   NM_078528.1  CG2286-RA, transcript variant A (ND75), mRNA 
0   NM_078684.2  CG3291-RA (pcm), mRNA 
0   NM_132084.2  CG12219-RA (CG12219), mRNA 
0   NM_079602.3  CG10045-RA, transcript variant A (GstD1), mRNA 
0   NM_001038953.1  CG10045-RB, transcript variant B (GstD1), mRNA 
0   NM_141513.1  CG7800-RA (CG7800), mRNA 
0   NM_141241.2  CG1129-RA, transcript variant A (CG1129), mRNA 
0   NM_169021.1  CG1129-RB, transcript variant B (CG1129), mRNA 
0   NM_206498.1  CG11648-RE, transcript variant E (Abd-B), mRNA 
0   NM_080157.2  CG11648-RB, transcript variant B (Abd-B), mRNA 
0   NM_169736.1  CG11648-RD, transcript variant D (Abd-B), mRNA 
0   NM_142320.1  CG11648-RA, transcript variant A (Abd-B), mRNA 
0   NM_169735.1  CG11648-RC, transcript variant C (Abd-B), mRNA 
0   NM_079100.2  CG17632-RA (bw), mRNA 
0   NM_078988.2  CG8529-RB, transcript variant B (Dyb), mRNA 
0   NM_001032236.1  CG8529-RE, transcript variant E (Dyb), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.