National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 13167R-1 
 Symbol CG13167  Full Name CG13167 
 CG No CG13167  Old CG No CG13167 
 Synonyms CG13167 
 Accession No (Link to NCBI) NM_136909.2 
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees viable 
 Map Viewer
[Please submit your publication]
Umetsu D, Dunst S, Dahmann C.
An RNA interference screen for genes required to shape the anteroposterior compartment boundary in Drosophila identifies the Eph receptor.
PLoS ONE (2014) 9(12) e114340 [ PubMed ID = 25473846 ] [ RRC reference ]

Umemori M, Habara O, Iwata T, Maeda K, Nishinoue K, Okabe A, Takemura M, Takahashi K, Saigo K, Ueda R, Adachi-Yamada T.
RNAi-mediated knockdown showing impaired cell survival in Drosophila wing imaginal disc.
Gene Regul Syst Bio (2009) 3 11-20 [ PubMed ID = 19838331 ] [ RRC reference ]  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
 Primer Seq. 3'
 Predicted Fragment Size
 IR fragment full Seq
 in silico PCR Fragment
 Assemble Data

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     1   ATGGCCAAACGCGATATCCTGCCCATCTTTCCATCCCGCGCCAATTCGGTGATCATGAAG 60

                           |||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| silico     61  CAGCGCGT-TTTGGCGGCTAGAAGGGGCGTGGGTCTCCTCAAGCGGAAGCGGGACGCCAT 120

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     121 CGATATGAAGCTACGCGAATTGCGTCGCATCCGCTTCGACCAGGACATGCACGGCGATGA 180

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     181 GGCGATGCGCAATGCCATATTCTCGATGGCAAAGGCCAATCTTCTGGGCGCCGATTTCAA 240

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     241 GCCGCAGATGGTAAGCCGCAGCCACGTGGCAACCGTATCGCTACGCCGCACGGAGATCAA 300

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     301 AATTGTGGGCGTCAAGCTGAACACCCTGGAGCTGGAGACGAAGGGCGTGGGCGCTTTTCC 360

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     361 GCTGGCTGGTCTCAGCTGTGGCGGTATGCAAGTGAGCCGAATCAGGGACTCCTATACGAA 420

                           |||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| silico     421 GGCACTCAAGGCACTGGTGGAGTTCGCCTCTCTGGAATACCAAGTGCGAATGCTGGAGGC 480

13167R-1.IR_full       481 AGCCTCGTTGCAGACCAACAT 501
                           ||||||||||||||||||||| silico     481 AGCCTCGTTGCAGACCAACAT 501

 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_136909.2  CG13167-RA (CG13167), mRNA 
0.41   NM_166698.1  CG30427-RA, transcript variant A (CG30427), mRNA 
0.41   NM_166699.1  CG30427-RD, transcript variant D (CG30427), mRNA 
0.41   NM_166697.1  CG30427-RC, transcript variant C (CG30427), mRNA 
0.41   NM_138136.2  CG30427-RB, transcript variant B (CG30427), mRNA 
0   NM_170326.2  CG31068-RA (CG31068), mRNA 
0   NM_136386.2  CG3409-RA (CG3409), mRNA 
0   NM_165219.1  CG6667-RC, transcript variant C (dl), mRNA 
0   NM_001038897.1  CG33971-RA (CG33971), mRNA 
0   NM_143313.1  CG5639-RA (CG5639), mRNA 
0   NM_169867.1  CG16718-RB, transcript variant B (CG16718), mRNA 
0   NM_142563.1  CG16718-RA, transcript variant A (CG16718), mRNA 
0   NM_168497.1  CG32105-RB (CG32105), mRNA 
0   NM_167152.1  CG2286-RB, transcript variant B (ND75), mRNA 
0   NM_078528.1  CG2286-RA, transcript variant A (ND75), mRNA 
0   NM_078684.2  CG3291-RA (pcm), mRNA 
0   NM_132084.2  CG12219-RA (CG12219), mRNA 
0   NM_079602.3  CG10045-RA, transcript variant A (GstD1), mRNA 
0   NM_001038953.1  CG10045-RB, transcript variant B (GstD1), mRNA 
0   NM_141513.1  CG7800-RA (CG7800), mRNA 
0   NM_141241.2  CG1129-RA, transcript variant A (CG1129), mRNA 
0   NM_169021.1  CG1129-RB, transcript variant B (CG1129), mRNA 
0   NM_206498.1  CG11648-RE, transcript variant E (Abd-B), mRNA 
0   NM_080157.2  CG11648-RB, transcript variant B (Abd-B), mRNA 
0   NM_169736.1  CG11648-RD, transcript variant D (Abd-B), mRNA 
0   NM_142320.1  CG11648-RA, transcript variant A (Abd-B), mRNA 
0   NM_169735.1  CG11648-RC, transcript variant C (Abd-B), mRNA 
0   NM_079100.2  CG17632-RA (bw), mRNA 
0   NM_078988.2  CG8529-RB, transcript variant B (Dyb), mRNA 
0   NM_001032236.1  CG8529-RE, transcript variant E (Dyb), mRNA 
 Wing Disc
JNK signal
Caspase-3 signal
Dcompartment   Penetrance

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.