National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 13160R-1 
 Symbol CG13160  Full Name CG13160 
 CG No CG13160  Old CG No CG13160 
 Synonyms CG13160 
 Accession No (Link to NCBI) NM_165890.2 
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees pupal lethal 
 Map Viewer
 Reference
[Please submit your publication]
Umetsu D, Dunst S, Dahmann C.
An RNA interference screen for genes required to shape the anteroposterior compartment boundary in Drosophila identifies the Eph receptor.
PLoS ONE (2014) 9(12) e114340 [ PubMed ID = 25473846 ] [ RRC reference ]

Umemori M, Habara O, Iwata T, Maeda K, Nishinoue K, Okabe A, Takemura M, Takahashi K, Saigo K, Ueda R, Adachi-Yamada T.
RNAi-mediated knockdown showing impaired cell survival in Drosophila wing imaginal disc.
Gene Regul Syst Bio (2009) 3 11-20 [ PubMed ID = 19838331 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgTTCGGGGTCTGAGAACCTAAT 
 Primer Seq. 3'
aatctagaggtaccAACCCGGCTTGGTATCGTAGT 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 TTCGGGGTCT GAGAACCTAA TAATCGAGGT GGATGAGGAC AAGATCCGTT GCAAGCAGTA 
0061 TTCCTGGTAC TTTGCCCCCA CCTACCTACT GTTCTGGGTG GGTCTCTTCT TCGCCGTCAT 
0121 CTATCCACTT TTCCAGGCCT TGCCCACCGG AATCAAAATC TCCGAGGAGG CGGATAAACC 
0181 GGGACAATTC GTGGCCGAGA GAGCTCAGGA AATACTGCTG AAAATAAGTC GATTGGGACC 
0241 CCGTGTGGTG GGTGATGTTG ATAATGAAGT CACAGTTGTG AATTTGCTGC TCGCTGAAAT 
0301 CGAAAAAGTG CGCCAGGTGC TGCGAGACGA TGTCTATGAA ATGGAGGTGG AGGTGCAACG 
0361 GGCATCCGGA TCCTACTTGA TCAAAGGCCT AACGAATCAC TATCAGGGTG TGCAGAATGT 
0421 GATCGTTAGA CTGAGTACGA AGAGCTCAAA TAGCACCTCC TACCTTTTGG TCAATAGTCA 
0481 CTACGATACC AAGCCGGGTT  
 in silico PCR Fragment
0001 TTCGGGGTCT GAGAACCTAA TAATCGAGGT GGATGAGGAC AAGATCCGTT GCAAGCAGTA 
0061 TTCCTGGTAC TTTGCCCCCA TCTACCTCCT GTTCTGGGTG GGTCTCTTCT TCGCCGTCAT 
0121 ATATCCACTT TTCCAGGCCT TGCCCACCGG AATCAAAATC TCCGAGGAGG CGGATAAACC 
0181 GGGACAATTC GTGGCCGAGA GAGCTCAGGA AATACTGCTG CAAATAAGTC GATTGGGACC 
0241 CCGTGTGGTG GGTGATGTTG ATAATGAAGT CACAGTTGTG AATTTGCTGC TCGCTGAAAT 
0301 CGAAAAAGTG CGCCAGGTGC TGCGAGACGA TGTCTATGAA ATGGAGGTGG AGGTGCAACG 
0361 GGCATCCGGA TCCTACTTGA TCAAAGGCCT AACGAATCAC TATCAGGGTG TGCAGAATGT 
0421 GATCGTTAGA CTGAGTACGA AGAGCTCAAA TAGCACCTCC TACCTTTTGG TCAATAGTCA 
0481 CTACGATACC AAGCCGGGTT  
 Assemble Data

13160R-1.IR_full       1   TTCGGGGTCTGAGAACCTAATAATCGAGGTGGATGAGGACAAGATCCGTTGCAAGCAGTA 60
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
13160R-1.in silico     1   TTCGGGGTCTGAGAACCTAATAATCGAGGTGGATGAGGACAAGATCCGTTGCAAGCAGTA 60


13160R-1.IR_full       61  TTCCTGGTACTTTGCCCCCACCTACCTACTGTTCTGGGTGGGTCTCTTCTTCGCCGTCAT 120
                           |||||||||||||||||||| |||||| ||||||||||||||||||||||||||||||||
13160R-1.in silico     61  TTCCTGGTACTTTGCCCCCATCTACCTCCTGTTCTGGGTGGGTCTCTTCTTCGCCGTCAT 120


13160R-1.IR_full       121 CTATCCACTTTTCCAGGCCTTGCCCACCGGAATCAAAATCTCCGAGGAGGCGGATAAACC 180
                            |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
13160R-1.in silico     121 ATATCCACTTTTCCAGGCCTTGCCCACCGGAATCAAAATCTCCGAGGAGGCGGATAAACC 180


13160R-1.IR_full       181 GGGACAATTCGTGGCCGAGAGAGCTCAGGAAATACTGCTGAAAATAAGTCGATTGGGACC 240
                           |||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||
13160R-1.in silico     181 GGGACAATTCGTGGCCGAGAGAGCTCAGGAAATACTGCTGCAAATAAGTCGATTGGGACC 240


13160R-1.IR_full       241 CCGTGTGGTGGGTGATGTTGATAATGAAGTCACAGTTGTGAATTTGCTGCTCGCTGAAAT 300
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
13160R-1.in silico     241 CCGTGTGGTGGGTGATGTTGATAATGAAGTCACAGTTGTGAATTTGCTGCTCGCTGAAAT 300


13160R-1.IR_full       301 CGAAAAAGTGCGCCAGGTGCTGCGAGACGATGTCTATGAAATGGAGGTGGAGGTGCAACG 360
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
13160R-1.in silico     301 CGAAAAAGTGCGCCAGGTGCTGCGAGACGATGTCTATGAAATGGAGGTGGAGGTGCAACG 360


13160R-1.IR_full       361 GGCATCCGGATCCTACTTGATCAAAGGCCTAACGAATCACTATCAGGGTGTGCAGAATGT 420
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
13160R-1.in silico     361 GGCATCCGGATCCTACTTGATCAAAGGCCTAACGAATCACTATCAGGGTGTGCAGAATGT 420


13160R-1.IR_full       421 GATCGTTAGACTGAGTACGAAGAGCTCAAATAGCACCTCCTACCTTTTGGTCAATAGTCA 480
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
13160R-1.in silico     421 GATCGTTAGACTGAGTACGAAGAGCTCAAATAGCACCTCCTACCTTTTGGTCAATAGTCA 480


13160R-1.IR_full       481 CTACGATACCAAGCCGGGTT 500
                           ||||||||||||||||||||
13160R-1.in silico     481 CTACGATACCAAGCCGGGTT 500

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_165890.2  CG13160-RA (CG13160), mRNA 
0.41   NM_166988.3  CG2947-RA, transcript variant A (CG2947), mRNA 
0.41   NM_001014719.1  CG2947-RC, transcript variant C (CG2947), mRNA 
0.41   NM_166989.3  CG2947-RB, transcript variant B (CG2947), mRNA 
0.41   NM_130718.3  CG32789-RA (CG32789), mRNA 
0   19  29  NM_176155.1  CG33012-RB, transcript variant B (CG33012), mRNA 
0   19  29  NM_176154.1  CG33012-RA, transcript variant A (CG33012), mRNA 
0   11  NM_137572.2  CG10062-RA (CG10062), mRNA 
0   10  NM_206360.1  CG33261-RF, transcript variant F (Trl), mRNA 
0   NM_206357.2  CG33261-RD, transcript variant D (Trl), mRNA 
0   NM_001038926.1  CG33261-RI, transcript variant I (Trl), mRNA 
0   NM_206356.2  CG33261-RB, transcript variant B (Trl), mRNA 
0   NM_206358.2  CG33261-RA, transcript variant A (Trl), mRNA 
0   NM_080051.2  CG1214-RA (ru), mRNA 
0   NM_144047.1  CG18679-RA (CG18679), mRNA 
0   NM_206573.1  CG31094-RB, transcript variant B (LpR1), mRNA 
0   NM_170240.2  CG31094-RA, transcript variant A (LpR1), mRNA 
0   NM_136126.3  CG10195-RA (CG10195), mRNA 
0   NM_080057.2  CG2708-RA (Tom34), mRNA 
0   NM_166342.1  CG11961-RA, transcript variant A (CG11961), mRNA 
0   NM_137569.3  CG11961-RB, transcript variant B (CG11961), mRNA 
0   NM_206096.1  CG13207-RD, transcript variant D (nompA), mRNA 
0   NM_165822.2  CG13207-RA, transcript variant A (nompA), mRNA 
0   NM_165821.2  CG13207-RC, transcript variant C (nompA), mRNA 
0   NM_080092.2  CG13207-RB, transcript variant B (nompA), mRNA 
0   NM_057245.2  CG6189-RA (l(1)1Bi), mRNA 
0   23  NM_165889.1  CG30043-RA (CG30043), mRNA 
0   NM_132796.2  CG11655-RA (CG11655), mRNA 
0   21  NM_165888.2  CG30049-RA (CG30049), mRNA 
0   13  NM_165887.1  CG30047-RA (CG30047), mRNA 
 Wing Disc
GFP
Puc
Caspase
DAPI
Merge
Figure
JNK signal
N
 
DB
 
DC
 
DM
 
VM
 
VB
 
Caspase-3 signal
N
 
DB
DC
DM
 
VM
 
VB
 
Dcompartment   Penetrance
     

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.