National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 13155R-4 
 Symbol CG13155  Full Name CG13155 
 CG No CG13155  Old CG No CG13155 
 Synonyms CG13155 
 Accession No (Link to NCBI) NM_136926.1 
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees pupal lethal 
 Map Viewer
 Reference
[Please submit your publication]
Umemori M, Habara O, Iwata T, Maeda K, Nishinoue K, Okabe A, Takemura M, Takahashi K, Saigo K, Ueda R, Adachi-Yamada T.
RNAi-mediated knockdown showing impaired cell survival in Drosophila wing imaginal disc.
Gene Regul Syst Bio (2009) 3 11-20 [ PubMed ID = 19838331 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgCGCTTGCTGACTGCACTATTG 
 Primer Seq. 3'
aatctagaggtaccTTGATATGGCAGCCATCGTCG 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 CGCTTGCTGA CTGCACTATT GCTGATCGCG GCTTGCAgGG CCGAGGATCC AGATTTGGGT 
0061 CAGGATCAGG ATCAGGCGAA GATCACGTTT AAGCCGGGCC GATATGTGCC ACGCCTGCAC 
0121 GGTGCCACGG GTTGGTATGT TCCGGATGAT AGTGGAAAGT ACCGGCACGA TCCCAGGCCC 
0181 TATGACGGCG GCTATGGAGA TCGTGGTGTT CCCTATGACT CCGATTTGAG CGGCATTTTC 
0241 CGGAATGCCC AGCGCCAACT GGAGGCAAAG GTCCAGGAGC GCCGGTGAAG GTCTATCCCT 
0301 CGGTCCACGA GATCATCTGC GATTCATGAT CGACTTTAAT TTCAATGGCA CCGGCTGGCA 
0361 GATAATCCAG TTTCAATGGG TACGAGATGG CGATGAGTCC CATCCAGACA CCAAGGAGTA 
0421 CAGCTACTTG ACGGAGAACA AGCTATGGGA CTCGGATCAG GCCTATGCGT ACCAGGAGCC 
0481 CGACGATGGC TGCCATATCA A 
 in silico PCR Fragment
0001 CGCTTGCTGA CTGCACTATT GCTGATCGCG GCTTGCAGGG CCGAGGATCC AGATTTGGGT 
0061 CAGGATCAGG ATCAGGCGAA GATCACGTTT AAGCCGGGCC GATATGTGCC ACGCCTGCAC 
0121 GGTGCCACGG GTTGGTATGT TCCGGATGAT AGTGGAAAGT ACCGGCACGA TCCCAGGCCC 
0181 TATGACGGCG GCTATGGAGA TCGTGGTGTT CCCTATGACT CCGATTTGAG CGGCATTTTC 
0241 CGGAATGCCC AGCGCCAACT GGAGGCAAAG GTCCAGGAG- GCCGGTGAAG GTCTATCCCT 
0301 CGGTCCACGA GATCATCTGC GATTCATGAT CGACTTTAAT TTCAATGGCA CCGGCTGGCA 
0361 GATAATCCAG TTTCAATGGG TACGAGATGG CGATGAGTCC CATCCAGACA CCAAGGAGTA 
0421 CAGCTACTTG ACGGAGAACA AGCTATGGGA CTCGGATCAG GCCTATGCGT ACCAGGAGCC 
0481 CGACGATGGC TGCCATATCA A 
 Assemble Data

13155R-4.IR_full       1   CGCTTGCTGACTGCACTATTGCTGATCGCGGCTTGCAGGGCCGAGGATCCAGATTTGGGT 60
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
13155R-4.in silico     1   CGCTTGCTGACTGCACTATTGCTGATCGCGGCTTGCAGGGCCGAGGATCCAGATTTGGGT 60


13155R-4.IR_full       61  CAGGATCAGGATCAGGCGAAGATCACGTTTAAGCCGGGCCGATATGTGCCACGCCTGCAC 120
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
13155R-4.in silico     61  CAGGATCAGGATCAGGCGAAGATCACGTTTAAGCCGGGCCGATATGTGCCACGCCTGCAC 120


13155R-4.IR_full       121 GGTGCCACGGGTTGGTATGTTCCGGATGATAGTGGAAAGTACCGGCACGATCCCAGGCCC 180
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
13155R-4.in silico     121 GGTGCCACGGGTTGGTATGTTCCGGATGATAGTGGAAAGTACCGGCACGATCCCAGGCCC 180


13155R-4.IR_full       181 TATGACGGCGGCTATGGAGATCGTGGTGTTCCCTATGACTCCGATTTGAGCGGCATTTTC 240
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
13155R-4.in silico     181 TATGACGGCGGCTATGGAGATCGTGGTGTTCCCTATGACTCCGATTTGAGCGGCATTTTC 240


13155R-4.IR_full       241 CGGAATGCCCAGCGCCAACTGGAGGCAAAGGTCCAGGAGCGCCGGTGAAGGTCTATCCCT 300
                           ||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||
13155R-4.in silico     241 CGGAATGCCCAGCGCCAACTGGAGGCAAAGGTCCAGGAG-GCCGGTGAAGGTCTATCCCT 300


13155R-4.IR_full       301 CGGTCCACGAGATCATCTGCGATTCATGATCGACTTTAATTTCAATGGCACCGGCTGGCA 360
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
13155R-4.in silico     301 CGGTCCACGAGATCATCTGCGATTCATGATCGACTTTAATTTCAATGGCACCGGCTGGCA 360


13155R-4.IR_full       361 GATAATCCAGTTTCAATGGGTACGAGATGGCGATGAGTCCCATCCAGACACCAAGGAGTA 420
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
13155R-4.in silico     361 GATAATCCAGTTTCAATGGGTACGAGATGGCGATGAGTCCCATCCAGACACCAAGGAGTA 420


13155R-4.IR_full       421 CAGCTACTTGACGGAGAACAAGCTATGGGACTCGGATCAGGCCTATGCGTACCAGGAGCC 480
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
13155R-4.in silico     421 CAGCTACTTGACGGAGAACAAGCTATGGGACTCGGATCAGGCCTATGCGTACCAGGAGCC 480


13155R-4.IR_full       481 CGACGATGGCTGCCATATCAA 501
                           |||||||||||||||||||||
13155R-4.in silico     481 CGACGATGGCTGCCATATCAA 501

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_136926.1  CG13155-RA (CG13155), mRNA 
0.2   NM_143245.2  CG14247-RA (CG14247), mRNA 
0   16  37  NM_206723.1  CG8260-RB, transcript variant B (CG8260), mRNA 
0   16  35  NM_132841.1  CG8260-RA, transcript variant A (CG8260), mRNA 
0   NM_078749.3  CG2937-RA (mRpS2), mRNA 
0   10  12  NM_167285.2  CG11727-RA, transcript variant A (CG11727), mRNA 
0   10  12  NM_132488.3  CG11727-RB, transcript variant B (CG11727), mRNA 
0   NM_165892.2  CG8502-RC, transcript variant C (CG8502), mRNA 
0   NM_132724.2  CG1810-RA (mRNA-capping-enzyme), mRNA 
0   NM_136928.3  CG8502-RA, transcript variant A (CG8502), mRNA 
0   13  18  NM_134474.4  CG32532-RA (CG32532), mRNA 
0   10  29  NM_132457.1  CG11122-RA (CG11122), mRNA 
0   16  NM_136777.2  CG30015-RB, transcript variant B (CG30015), mRNA 
0   13  NM_165802.1  CG30015-RA, transcript variant A (CG30015), mRNA 
0   NM_057411.3  CG10079-RB, transcript variant B (Egfr), mRNA 
0   NM_135257.1  CG4496-RA (CG4496), mRNA 
0   NM_057410.3  CG10079-RA, transcript variant A (Egfr), mRNA 
0   NM_165106.4  CG31732-RB, transcript variant B (yuri), mRNA 
0   NM_165107.2  CG31732-RC, transcript variant C (yuri), mRNA 
0   NM_165109.2  CG31732-RD, transcript variant D (yuri), mRNA 
0   NM_140580.1  CG5414-RA (CG5414), mRNA 
0   NM_134496.2  CG14215-RA (CG14215), mRNA 
0   15  NM_138062.2  CG3394-RB, transcript variant B (CG3394), mRNA 
0   15  NM_166666.1  CG3394-RA, transcript variant A (CG3394), mRNA 
0   NM_143055.2  CG11120-RA, transcript variant A (CG11120), mRNA 
0   NM_170183.2  CG11120-RB, transcript variant B (CG11120), mRNA 
0   12  NM_140898.3  CG32217-RA (Su(Tpl)), mRNA 
0   NM_168468.1  CG32091-RB (CG32091), mRNA 
0   NM_167436.1  CG6170-RB, transcript variant B (HDAC6), mRNA 
0   NM_167437.1  CG6170-RC, transcript variant C (HDAC6), mRNA 
 Wing Disc
GFP
Puc
Caspase
DAPI
Merge
Figure
JNK signal
N
 
DB
+- 
DC
DM
 
VM
 
VB
 
Caspase-3 signal
N
++ 
DB
++ 
DC
DM
++ 
VM
VB
 
Dcompartment   Penetrance
     

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.