National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock discarded request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 13155R-3 
 Symbol CG13155  Full Name CG13155 
 CG No CG13155  Old CG No CG13155 
 Synonyms CG13155 
 Accession No (Link to NCBI) NM_136926.1 
 Inserted Chr. ll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees pupal lethal 
 Map Viewer
[Please submit your publication]
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
 Primer Seq. 3'
 Predicted Fragment Size
 IR fragment full Seq
 in silico PCR Fragment
 Assemble Data

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     1   CGCTTGCTGACTGCACTATTGCTGATCGCGGCTTGCAGGGCCGAGGATCCAGATTTGGGT 60

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     61  CAGGATCAGGATCAGGCGAAGATCACGTTTAAGCCGGGCCGATATGTGCCACGCCTGCAC 120

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     121 GGTGCCACGGGTTGGTATGTTCCGGATGATAGTGGAAAGTACCGGCACGATCCCAGGCCC 180

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     181 TATGACGGCGGCTATGGAGATCGTGGTGTTCCCTATGACTCCGATTTGAGCGGCATTTTC 240

                           ||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| silico     241 CGGAATGCCCAGCGCCAACTGGAGGCAAAGGTCCAGGAG-GCCGGTGAAGGTCTATCCCT 300

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     301 CGGTCCACGAGATCATCTGCGATTCATGATCGACTTTAATTTCAATGGCACCGGCTGGCA 360

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     361 GATAATCCAGTTTCAATGGGTACGAGATGGCGATGAGTCCCATCCAGACACCAAGGAGTA 420

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     421 CAGCTACTTGACGGAGAACAAGCTATGGGACTCGGATCAGGCCTATGCGTACCAGGAGCC 480

13155R-3.IR_full       481 CGACGATGGCTGCCATATCAA 501
                           ||||||||||||||||||||| silico     481 CGACGATGGCTGCCATATCAA 501

 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_136926.1  CG13155-RA (CG13155), mRNA 
0.2   NM_143245.2  CG14247-RA (CG14247), mRNA 
0   16  37  NM_206723.1  CG8260-RB, transcript variant B (CG8260), mRNA 
0   16  35  NM_132841.1  CG8260-RA, transcript variant A (CG8260), mRNA 
0   NM_078749.3  CG2937-RA (mRpS2), mRNA 
0   10  12  NM_167285.2  CG11727-RA, transcript variant A (CG11727), mRNA 
0   10  12  NM_132488.3  CG11727-RB, transcript variant B (CG11727), mRNA 
0   NM_165892.2  CG8502-RC, transcript variant C (CG8502), mRNA 
0   NM_132724.2  CG1810-RA (mRNA-capping-enzyme), mRNA 
0   NM_136928.3  CG8502-RA, transcript variant A (CG8502), mRNA 
0   13  18  NM_134474.4  CG32532-RA (CG32532), mRNA 
0   10  29  NM_132457.1  CG11122-RA (CG11122), mRNA 
0   16  NM_136777.2  CG30015-RB, transcript variant B (CG30015), mRNA 
0   13  NM_165802.1  CG30015-RA, transcript variant A (CG30015), mRNA 
0   NM_057411.3  CG10079-RB, transcript variant B (Egfr), mRNA 
0   NM_135257.1  CG4496-RA (CG4496), mRNA 
0   NM_057410.3  CG10079-RA, transcript variant A (Egfr), mRNA 
0   NM_165106.4  CG31732-RB, transcript variant B (yuri), mRNA 
0   NM_165107.2  CG31732-RC, transcript variant C (yuri), mRNA 
0   NM_165109.2  CG31732-RD, transcript variant D (yuri), mRNA 
0   NM_140580.1  CG5414-RA (CG5414), mRNA 
0   NM_134496.2  CG14215-RA (CG14215), mRNA 
0   15  NM_138062.2  CG3394-RB, transcript variant B (CG3394), mRNA 
0   15  NM_166666.1  CG3394-RA, transcript variant A (CG3394), mRNA 
0   NM_143055.2  CG11120-RA, transcript variant A (CG11120), mRNA 
0   NM_170183.2  CG11120-RB, transcript variant B (CG11120), mRNA 
0   12  NM_140898.3  CG32217-RA (Su(Tpl)), mRNA 
0   NM_168468.1  CG32091-RB (CG32091), mRNA 
0   NM_167436.1  CG6170-RB, transcript variant B (HDAC6), mRNA 
0   NM_167437.1  CG6170-RC, transcript variant C (HDAC6), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.