National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
Notice:

Suspension of shipments during Golden Week Holidays: From 30 April to 14 May, deadline 17 April.

NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock discarded request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 13151R-2 
 Symbol CG13151  Full Name CG13151 
 CG No CG13151  Old CG No CG13151 
 Synonyms CG13151 
 Accession No (Link to NCBI) NM_136949.1 
 Inserted Chr. ll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees viable 
 Map Viewer
 Reference
[Please submit your publication]
Nitta Y, Yamazaki D, Sugie A, Hiroi M, Tabata T.
DISCO Interacting Protein 2 regulates axonal bifurcation and guidance of Drosophila mushroom body neurons.
Dev Biol (2017) 421(2) 233-244 [ PubMed ID = 27908785 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgAGCGACCAGGAGGAAGAAGAC 
 Primer Seq. 3'
aatctagaggtaccCTCTGGACACTTGTGGCCGTT 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 AGCGACCAGG AGGAAGAAGA CGAGGATGGT GAAAAGATGG AGGTGGAGGA GCGGTTGCCG 
0061 CCGGTCGATT CCACAGTCCA AAGTGCCTCC TTTAACGGAG ATGACTCCGA TCCGCTACAG 
0121 GAAGCAGTAT GCAATTTTCC CTGGATTTTC GAGGACAGCG ACATGCTGAT GAACGAGGAC 
0181 CAACTGGCTG ACGTGGTGCT GAAGAAGGAG GATTCCGCCA GGCCAGCTGC CCCGAAGCGA 
0241 GGACGTGGTC GTCCACCAAA TAATAACGGA AACTACACAT CTCCTTGTGG GCAGCTATGG 
0301 AGCGTGACCA GGAGCCCAGA TATTTCTGCA GAGGATCTAN CCCTTTTGGG GCAACAgGNC 
0361 TGTGGCAAGG GACCCGCCCG AACAGTGTCC AATGCAGTGG AAGCATGGAT GCTGCTCTTC 
0421 GATGATGAAA TGCTGCGGTC TTTACTTCGC CATATCAATG AACAGATGCG TAAGCGGAGA 
0481 ACGGCCACAA GTGTCCAGAG  
 in silico PCR Fragment
0001 AGCGACCAGG AGGAAGAAGA CGAGGATGGT GAAAAGATGG AGGTGGAGGA GCGGCTGCCG 
0061 CCGGTCGATT CCACAGTCCA AAGTGCCTCC TTTAACGGAG ATGACTCCGA TCCGCTACAG 
0121 GAAGCAGTAT GCAATTTTCC CTGGATTTTC GAGGACAGCG ACATGCTGAT GAACGAGGAC 
0181 CAACTGGCTG ACGTGGTGCT GAAGAAGGAG GATTCCGCCA GGCCAGCTGC CCCGAAGCGA 
0241 GGACGTGGTC GTCCACCAAA TAATAACGGA AACTACACAT CTCCTTGTGG GCAGCTATGG 
0301 AGCGTGACCA GGAGCCCAGA TATTTCTGCA GAGGATCTAC CCCTTTTGGG GCAACAGGCC 
0361 TGTGGCAAGG GACCCGCCCG AACAGTGTCC AATGCAGTGG AAGCATGGAT GCTGCTCTTC 
0421 GATGATGAAA TGCTGCGGTC TTTACTTCGC CATATCAATG AACAGATGCG TAAGCGGAGA 
0481 ACGGCCACAA GTGTCCAGAG  
 Assemble Data

13151R-2.IR_full       1   AGCGACCAGGAGGAAGAAGACGAGGATGGTGAAAAGATGGAGGTGGAGGAGCGGTTGCCG 60
                           |||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||
13151R-2.in silico     1   AGCGACCAGGAGGAAGAAGACGAGGATGGTGAAAAGATGGAGGTGGAGGAGCGGCTGCCG 60


13151R-2.IR_full       61  CCGGTCGATTCCACAGTCCAAAGTGCCTCCTTTAACGGAGATGACTCCGATCCGCTACAG 120
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
13151R-2.in silico     61  CCGGTCGATTCCACAGTCCAAAGTGCCTCCTTTAACGGAGATGACTCCGATCCGCTACAG 120


13151R-2.IR_full       121 GAAGCAGTATGCAATTTTCCCTGGATTTTCGAGGACAGCGACATGCTGATGAACGAGGAC 180
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
13151R-2.in silico     121 GAAGCAGTATGCAATTTTCCCTGGATTTTCGAGGACAGCGACATGCTGATGAACGAGGAC 180


13151R-2.IR_full       181 CAACTGGCTGACGTGGTGCTGAAGAAGGAGGATTCCGCCAGGCCAGCTGCCCCGAAGCGA 240
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
13151R-2.in silico     181 CAACTGGCTGACGTGGTGCTGAAGAAGGAGGATTCCGCCAGGCCAGCTGCCCCGAAGCGA 240


13151R-2.IR_full       241 GGACGTGGTCGTCCACCAAATAATAACGGAAACTACACATCTCCTTGTGGGCAGCTATGG 300
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
13151R-2.in silico     241 GGACGTGGTCGTCCACCAAATAATAACGGAAACTACACATCTCCTTGTGGGCAGCTATGG 300


13151R-2.IR_full       301 AGCGTGACCAGGAGCCCAGATATTTCTGCAGAGGATCTANCCCTTTTGGGGCAACAGGNC 360
                           ||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
13151R-2.in silico     301 AGCGTGACCAGGAGCCCAGATATTTCTGCAGAGGATCTACCCCTTTTGGGGCAACAGGCC 360


13151R-2.IR_full       361 TGTGGCAAGGGACCCGCCCGAACAGTGTCCAATGCAGTGGAAGCATGGATGCTGCTCTTC 420
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
13151R-2.in silico     361 TGTGGCAAGGGACCCGCCCGAACAGTGTCCAATGCAGTGGAAGCATGGATGCTGCTCTTC 420


13151R-2.IR_full       421 GATGATGAAATGCTGCGGTCTTTACTTCGCCATATCAATGAACAGATGCGTAAGCGGAGA 480
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
13151R-2.in silico     421 GATGATGAAATGCTGCGGTCTTTACTTCGCCATATCAATGAACAGATGCGTAAGCGGAGA 480


13151R-2.IR_full       481 ACGGCCACAAGTGTCCAGAG 500
                           ||||||||||||||||||||
13151R-2.in silico     481 ACGGCCACAAGTGTCCAGAG 500

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_136949.1  CG13151-RA (CG13151), mRNA 
0.41   NM_079768.2  CG6238-RA, transcript variant A (ssh), mRNA 
0   22  NM_170139.1  CG31132-RA (BRWD3), mRNA 
0   NM_132968.1  CG5010-RA (CG5010), mRNA 
0   NM_136344.1  CG14470-RA (CG14470), mRNA 
0   NM_001043091.1  CG5748-RC, transcript variant C (Hsf), mRNA 
0   NM_057227.3  CG5748-RA, transcript variant A (Hsf), mRNA 
0   NM_001043090.1  CG5748-RD, transcript variant D (Hsf), mRNA 
0   NM_001043092.1  CG5748-RB, transcript variant B (Hsf), mRNA 
0   NM_168550.1  CG10089-RC, transcript variant C (CG10089), mRNA 
0   NM_168549.1  CG10089-RB, transcript variant B (CG10089), mRNA 
0   NM_168548.1  CG10089-RA, transcript variant A (CG10089), mRNA 
0   NM_136724.1  CG12911-RA (CG12911), mRNA 
0   12  NM_133112.1  CG7349-RA (CG7349), mRNA 
0   NM_138041.2  CG4049-RA (CG4049), mRNA 
0   NM_079268.2  CG10923-RA (Klp67A), mRNA 
0   14  NM_132989.2  CG8568-RA (CG8568), mRNA 
0   17  NM_138025.2  CG3121-RA (CG3121), mRNA 
0   20  NM_078816.2  CG7279-RA (Lip1), mRNA 
0   15  NM_001014591.1  CG8103-RB, transcript variant B (Mi-2), mRNA 
0   15  NM_140897.2  CG8103-RA, transcript variant A (Mi-2), mRNA 
0   10  NM_137196.1  CG12964-RA (CG12964), mRNA 
0   NM_140412.1  CG8833-RA (CG8833), mRNA 
0   NM_136445.2  CG1605-RA (az2), mRNA 
0   NM_166289.1  CG5186-RB, transcript variant B (slim), mRNA 
0   NM_079058.2  CG5186-RA, transcript variant A (slim), mRNA 
0   NM_139464.2  CG32306-RB, transcript variant B (CG32306), mRNA 
0   NM_206242.1  CG32306-RD, transcript variant D (CG32306), mRNA 
0   19  NM_080303.2  CG3707-RA, transcript variant A (wapl), mRNA 
0   18  NM_166931.1  CG3707-RB, transcript variant B (wapl), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.