National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 13123R-3 
 Symbol CG13123  Full Name CG13123 
 CG No CG13123  Old CG No CG13123 
 Synonyms CG13123 
 Accession No (Link to NCBI) NM_135471.1 
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees viable 
 Map Viewer
 Reference
[Please submit your publication]
Umemori M, Habara O, Iwata T, Maeda K, Nishinoue K, Okabe A, Takemura M, Takahashi K, Saigo K, Ueda R, Adachi-Yamada T.
RNAi-mediated knockdown showing impaired cell survival in Drosophila wing imaginal disc.
Gene Regul Syst Bio (2009) 3 11-20 [ PubMed ID = 19838331 ] [ RRC reference ]

Tiwari P, Kumar A, Das RN, Malhotra V, VijayRaghavan K.
A Tendon Cell Specific RNAi Screen Reveals Novel Candidates Essential for Muscle Tendon Interaction.
PLoS ONE (2015) 10(10) e0140976 [ PubMed ID = 26488612 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgTTGCTTCGTGGACAGCGCTTC 
 Primer Seq. 3'
aatctagaggtaccATAGATCCAGTCGTGGTTGGG 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 TTGCTTCGTG GACAGCGCTT CGGTGGATAT ACGGGAGCAC AGGAGCGGCG GCAGTTCGGA 
0061 TCAGACAGTC CTCCAGCTGA TAGAAGCCAT GTTCGGCTGG AACATAGCAC TTAATCTTAC 
0121 TGAGGAGCTG CCCATGATCT GTAATGATTG CTTGGAAGAT TGCCTGCAGC AGTACGCCTT 
0181 CTTCAGGAAG CTAACGTTCG CCAATNCAGC AGCTACTGCA GCTCTACAAC GAGGCGGAGG 
0241 TAGAAATGTG CCAAGTTAAG ATGGACGCAA CGGAGGAAGA GCCCGAAAAC CAGGCTAGTG 
0301 ATGAATTCGA GATACTGGAG GAATTcagga gGATACCACT GGATTATGTG GTTTTAGACC 
0361 CCGATCGTCC TACAGAAACA AGACAAACGA GGAGAAGGAC GGATAGCTGT ACGAAACCCT 
0421 CTCAAAGGCT GGCCAACCAA GATTCGCTGA TTGTCTCCGA GTTTTTACCT GCCACCACAG 
0481 CCCAACCACG ACTGGATCTA T 
 in silico PCR Fragment
0001 TTGCTTCGTG GACAGCGCTT CGGTGGATAT ACGGGAGCAC AGGAGCGGTG GCAGTTCGGA 
0061 TCAGACAGTC CTCCAGCTGA TAGAAGCCAT GTTCGGCTGG AACATAGCAC TTAATCTTAC 
0121 TGAGGAGCTG CCCATGATCT GTAATGATTG CTTGGAAGAT TGCCTGCAGC AGTACGCCTT 
0181 CTTCAGGAAG CTAACGTTCG CCAAT-CAGC AGCTACTGCA GCTCTACAAC GAGGCGGAGG 
0241 TAGAAATGTG CCAAGTTAAG ATGGACGCAA CGGAGGAAGA GCCCGAAAAC CAGGCTAGTG 
0301 ATGAATTCGA GATACTGGAG GAATTCAGGA GGATACCACT GGATTATGTG GTTTTAGACC 
0361 CCGATCGTCC TACAGAAACA AGACAAACGA GGAGAAGGAC GGATAGCTGT ACGAAACCCT 
0421 CTCAAAGGCT GGCCAACCAA GATTCGCTGA TTGTCTCCGA GTTTTTACCT GCCACCACAG 
0481 CCCAACCACG ACTGGATCTA T 
 Assemble Data

13123R-3.IR_full       1   TTGCTTCGTGGACAGCGCTTCGGTGGATATACGGGAGCACAGGAGCGGCGGCAGTTCGGA 60
                           |||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||
13123R-3.in silico     1   TTGCTTCGTGGACAGCGCTTCGGTGGATATACGGGAGCACAGGAGCGGTGGCAGTTCGGA 60


13123R-3.IR_full       61  TCAGACAGTCCTCCAGCTGATAGAAGCCATGTTCGGCTGGAACATAGCACTTAATCTTAC 120
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
13123R-3.in silico     61  TCAGACAGTCCTCCAGCTGATAGAAGCCATGTTCGGCTGGAACATAGCACTTAATCTTAC 120


13123R-3.IR_full       121 TGAGGAGCTGCCCATGATCTGTAATGATTGCTTGGAAGATTGCCTGCAGCAGTACGCCTT 180
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
13123R-3.in silico     121 TGAGGAGCTGCCCATGATCTGTAATGATTGCTTGGAAGATTGCCTGCAGCAGTACGCCTT 180


13123R-3.IR_full       181 CTTCAGGAAGCTAACGTTCGCCAATNCAGCAGCTACTGCAGCTCTACAACGAGGCGGAGG 240
                           ||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||
13123R-3.in silico     181 CTTCAGGAAGCTAACGTTCGCCAAT-CAGCAGCTACTGCAGCTCTACAACGAGGCGGAGG 240


13123R-3.IR_full       241 TAGAAATGTGCCAAGTTAAGATGGACGCAACGGAGGAAGAGCCCGAAAACCAGGCTAGTG 300
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
13123R-3.in silico     241 TAGAAATGTGCCAAGTTAAGATGGACGCAACGGAGGAAGAGCCCGAAAACCAGGCTAGTG 300


13123R-3.IR_full       301 ATGAATTCGAGATACTGGAGGAATTCAGGAGGATACCACTGGATTATGTGGTTTTAGACC 360
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
13123R-3.in silico     301 ATGAATTCGAGATACTGGAGGAATTCAGGAGGATACCACTGGATTATGTGGTTTTAGACC 360


13123R-3.IR_full       361 CCGATCGTCCTACAGAAACAAGACAAACGAGGAGAAGGACGGATAGCTGTACGAAACCCT 420
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
13123R-3.in silico     361 CCGATCGTCCTACAGAAACAAGACAAACGAGGAGAAGGACGGATAGCTGTACGAAACCCT 420


13123R-3.IR_full       421 CTCAAAGGCTGGCCAACCAAGATTCGCTGATTGTCTCCGAGTTTTTACCTGCCACCACAG 480
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
13123R-3.in silico     421 CTCAAAGGCTGGCCAACCAAGATTCGCTGATTGTCTCCGAGTTTTTACCTGCCACCACAG 480


13123R-3.IR_full       481 CCCAACCACGACTGGATCTAT 501
                           |||||||||||||||||||||
13123R-3.in silico     481 CCCAACCACGACTGGATCTAT 501

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_135471.1  CG13123-RA (CG13123), mRNA 
0   NM_167402.1  CG1517-RC, transcript variant C (na), mRNA 
0   NM_167401.1  CG1517-RB, transcript variant B (na), mRNA 
0   NM_143459.1  CG1964-RA (Kul), mRNA 
0   NM_140156.1  CG6418-RB (CG6418), mRNA 
0   NM_136864.2  CG13185-RA (CG13185), mRNA 
0   NM_140783.2  CG7285-RA (star1), mRNA 
0   10  NM_176556.1  CG33106-RA, transcript variant A (mask), mRNA 
0   10  NM_176557.1  CG33106-RB, transcript variant B (mask), mRNA 
0   NM_057523.3  CG18412-RA (ph-p), mRNA 
0   NM_169828.1  CG31229-RA (CG31229), mRNA 
0   NM_166897.1  CG11491-RC, transcript variant C (br), mRNA 
0   NM_166896.1  CG11491-RB, transcript variant B (br), mRNA 
0   NM_132482.2  CG11752-RA (CG11752), mRNA 
0   10  NM_176210.1  CG33197-RD, transcript variant D (mbl), mRNA 
0   10  NM_057445.2  CG1046-RA (zen), mRNA 
0   NM_001038809.1  CG17139-RA, transcript variant A (CG17139), mRNA 
0   NM_001038808.1  CG17140-RA, transcript variant A (CG17140), mRNA 
0   NM_130626.2  CG3835-RA, transcript variant A (CG3835), mRNA 
0   NM_166930.1  CG3835-RC, transcript variant C (CG3835), mRNA 
0   NM_166929.1  CG3835-RB, transcript variant B (CG3835), mRNA 
0   NM_001038807.1  CG17140-RB, transcript variant B (CG17140), mRNA 
0   NM_168357.2  CG32045-RB, transcript variant B (fry), mRNA 
0   NM_001043133.1  CG32045-RD, transcript variant D (fry), mRNA 
0   NM_080152.2  CG5092-RA (Tor), mRNA 
0   NM_176104.1  CG33087-RC (CG33087), mRNA 
0   NM_140498.1  CG7003-RA (CG7003), mRNA 
0   NM_078490.2  CG4528-RA (snf), mRNA 
0   NM_130616.2  CG4290-RA (CG4290), mRNA 
0   NM_057249.4  CG7793-RA (Sos), mRNA 
 Wing Disc
GFP
Puc
Caspase
DAPI
Merge
Figure
JNK signal
N
 
DB
 
DC
 
DM
 
VM
 
VB
 
Caspase-3 signal
N
 
DB
DC
DM
VM
VB
 
Dcompartment   Penetrance
   

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.