National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock discarded request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 1311R-1 
 Symbol CG1311  Full Name CG1311 
 CG No CG1311  Old CG No CG1311 
 Synonyms CG1311 
 Accession No (Link to NCBI) NM_139627.1 
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees viable 
 Map Viewer
 Reference
[Please submit your publication]
Umetsu D, Dunst S, Dahmann C.
An RNA interference screen for genes required to shape the anteroposterior compartment boundary in Drosophila identifies the Eph receptor.
PLoS ONE (2014) 9(12) e114340 [ PubMed ID = 25473846 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgATGGGCTGTGCGGAGAGCAAG 
 Primer Seq. 3'
aatctagaggtaccGGCGAACTCTCATGAACGGGA 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 ATGGGCTGTG CTGGAGAGNA AGGACGGCGA GGGGGAGGCG CAAAACAATA GGCCCAAATA 
0061 CCGGTCCTGC ACGGACACCT GCTGGCTGGC CATTTACATT ATATTCTGGC TGTTTTTGAT 
0121 AGTGATTGCC ATCTTTTCGT TCGTTTATGG AAATCCCCTG CGCATCATCA ATGGCTACGA 
0181 TTCCTTTGGC AACACCTGTG GCGTTAAGTA CAATGAAAAG TTCCAGGGAT TCCCGCTGTC 
0241 CGGCATGAAT ACACTCGACA AAGCCGGAGC TCTTCTATTT CGATGTCAAG GAGCTGAAAA 
0301 AGTCCCTCAA GATATGCGTT AAGTCATGTC CCGCCAAAAC TATGACCAAG GGCAGCGAGC 
0361 TGCTGGAATA CTACAGCCAA ACGGGCACAC ANNTCTGCAA ATACGACTAC AACATGCAGC 
0421 AGCTGACTAC GGCGGGCAAC GATGCCAAAA CGTTCAATTT cCNGGGCCCA TGTCCCAGTT 
0481 TTCCCGTTCA TGAGAGTTCN CC 
 in silico PCR Fragment
0001 ATGGGCTGTG C-GGAGAGCA AGGACGGCGA GGGGGAGGCG CAAAACAATA GGCCCAAATA 
0061 CCGGTCCTGC ACGGACACCT GCTGGCTGGC CATTTACATT ATATTCTGGC TGTTTTTGAT 
0121 AGTGATTGCC ATCTTTTCGT TCGTTTATGG AAATCCCCTG CGCATCATCA ATGGCTACGA 
0181 TTCCTTTGGC AACACCTGTG GCGTTAAGTA CAATGAAAAG TTCCAGGGAT TCCCGCTGTC 
0241 CGGCATGAAT ACACTCGAC- AAGCCGGAGC TCTTCTATTT CGATGTCAAG GAGCTGAAAA 
0301 AGTCCCTCAA GATATGCGTT AAGTCATGTC CCGCCAAAAC TATGACCAAG GGCAGCGAGC 
0361 TGCTGGAATA CTACAGCCAA ACGGGCACAC AGCTCTGCAA ATACGACTAC AACATGCAGC 
0421 AGCTGACTAC GGCGGGCAAC GATGCCAAAA CGTTCAATTT CCTGGGCCCA TGTCCCAGTT 
0481 TTCCCGTTCA TGAGAGTTCG CC 
 Assemble Data

1311R-1.IR_full       1   ATGGGCTGTGCTGGAGAGNAAGGACGGCGAGGGGGAGGCGCAAAACAATAGGCCCAAATA 60
                          ||||||||||| |||||| |||||||||||||||||||||||||||||||||||||||||
1311R-1.in silico     1   ATGGGCTGTGC-GGAGAGCAAGGACGGCGAGGGGGAGGCGCAAAACAATAGGCCCAAATA 60


1311R-1.IR_full       61  CCGGTCCTGCACGGACACCTGCTGGCTGGCCATTTACATTATATTCTGGCTGTTTTTGAT 120
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
1311R-1.in silico     61  CCGGTCCTGCACGGACACCTGCTGGCTGGCCATTTACATTATATTCTGGCTGTTTTTGAT 120


1311R-1.IR_full       121 AGTGATTGCCATCTTTTCGTTCGTTTATGGAAATCCCCTGCGCATCATCAATGGCTACGA 180
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
1311R-1.in silico     121 AGTGATTGCCATCTTTTCGTTCGTTTATGGAAATCCCCTGCGCATCATCAATGGCTACGA 180


1311R-1.IR_full       181 TTCCTTTGGCAACACCTGTGGCGTTAAGTACAATGAAAAGTTCCAGGGATTCCCGCTGTC 240
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
1311R-1.in silico     181 TTCCTTTGGCAACACCTGTGGCGTTAAGTACAATGAAAAGTTCCAGGGATTCCCGCTGTC 240


1311R-1.IR_full       241 CGGCATGAATACACTCGACAAAGCCGGAGCTCTTCTATTTCGATGTCAAGGAGCTGAAAA 300
                          ||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||
1311R-1.in silico     241 CGGCATGAATACACTCGAC-AAGCCGGAGCTCTTCTATTTCGATGTCAAGGAGCTGAAAA 300


1311R-1.IR_full       301 AGTCCCTCAAGATATGCGTTAAGTCATGTCCCGCCAAAACTATGACCAAGGGCAGCGAGC 360
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
1311R-1.in silico     301 AGTCCCTCAAGATATGCGTTAAGTCATGTCCCGCCAAAACTATGACCAAGGGCAGCGAGC 360


1311R-1.IR_full       361 TGCTGGAATACTACAGCCAAACGGGCACACANNTCTGCAAATACGACTACAACATGCAGC 420
                          |||||||||||||||||||||||||||||||  |||||||||||||||||||||||||||
1311R-1.in silico     361 TGCTGGAATACTACAGCCAAACGGGCACACAGCTCTGCAAATACGACTACAACATGCAGC 420


1311R-1.IR_full       421 AGCTGACTACGGCGGGCAACGATGCCAAAACGTTCAATTTCCNGGGCCCATGTCCCAGTT 480
                          |||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||
1311R-1.in silico     421 AGCTGACTACGGCGGGCAACGATGCCAAAACGTTCAATTTCCTGGGCCCATGTCCCAGTT 480


1311R-1.IR_full       481 TTCCCGTTCATGAGAGTTCNCC 502
                          ||||||||||||||||||| ||
1311R-1.in silico     481 TTCCCGTTCATGAGAGTTCGCC 502

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_139627.1  CG1311-RA (CG1311), mRNA 
0   NM_166318.1  CG15105-RB, transcript variant B (CG15105), mRNA 
0   NM_137546.2  CG15105-RA, transcript variant A (CG15105), mRNA 
0   NM_168309.1  CG5263-RB, transcript variant B (smg), mRNA 
0   NM_079263.2  CG5263-RA, transcript variant A (smg), mRNA 
0   NM_168310.1  CG5263-RC, transcript variant C (smg), mRNA 
0   NM_080376.1  CG8118-RA, transcript variant A (mam), mRNA 
0   NM_166030.1  CG8118-RB, transcript variant B (mam), mRNA 
0   NM_079073.1  CG8595-RA (Toll-7), mRNA 
0   11  NM_166141.2  CG8421-RD, transcript variant D (Asph), mRNA 
0   NM_079033.2  CG8421-RB, transcript variant B (Asph), mRNA 
0   NM_166140.1  CG8421-RA, transcript variant A (Asph), mRNA 
0   NM_135238.2  CG10354-RA (CG10354), mRNA 
0   NM_141654.1  CG16790-RA (CG16790), mRNA 
0   NM_001042930.1  CG17490-RB, transcript variant B (CG17490), mRNA 
0   NM_168102.1  CG32239-RA (Gef64C), mRNA 
0   NM_166056.1  CG10110-RB, transcript variant B (cpsf), mRNA 
0   NM_206111.1  CG10110-RA, transcript variant A (cpsf), mRNA 
0   NM_175991.1  CG10595-RA, transcript variant A (d), mRNA 
0   NM_205939.1  CG10595-RC, transcript variant C (d), mRNA 
0   NM_205940.1  CG10595-RB, transcript variant B (d), mRNA 
0   28  NM_167065.1  CG32744-RA (CG32744), mRNA 
0   NM_169627.1  CG4264-RD, transcript variant D (Hsc70-4), mRNA 
0   NM_169625.1  CG4264-RB, transcript variant B (Hsc70-4), mRNA 
0   NM_169626.1  CG4264-RC, transcript variant C (Hsc70-4), mRNA 
0   NM_176502.1  CG4264-RE, transcript variant E (Hsc70-4), mRNA 
0   NM_079632.4  CG4264-RA, transcript variant A (Hsc70-4), mRNA 
0   NM_176503.1  CG4264-RF, transcript variant F (Hsc70-4), mRNA 
0   NM_078638.2  CG9908-RA, transcript variant A (disco), mRNA 
0   NM_167042.2  CG3187-RB, transcript variant B (Sirt4), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.