National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock discarded request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 13116R-3 
 Symbol CG13116  Full Name CG13116 
 CG No CG13116  Old CG No CG13116 
 Synonyms CG13116 
 Accession No (Link to NCBI) NM_135462.2 
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees semi-lethal 
 Map Viewer
 Reference
[Please submit your publication]
Tiwari P, Kumar A, Das RN, Malhotra V, VijayRaghavan K.
A Tendon Cell Specific RNAi Screen Reveals Novel Candidates Essential for Muscle Tendon Interaction.
PLoS One (2015) 10(10) e0140976 [ PubMed ID = 26488612 ] [ RRC reference ]

Umemori M, Habara O, Iwata T, Maeda K, Nishinoue K, Okabe A, Takemura M, Takahashi K, Saigo K, Ueda R, Adachi-Yamada T.
RNAi-mediated knockdown showing impaired cell survival in Drosophila wing imaginal disc.
Gene Regul Syst Bio (2009) 3 11-20 [ PubMed ID = 19838331 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgTCGAGCTGATCACGGTGCTGG 
 Primer Seq. 3'
aatctagaggtaccCCTCAAGCTGGGACTCGGACT 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 TCGAGCTGAT CACGGTGCTG GTGTATTGGG TGATCATCAC GCCCACCACC TACAAGTACT 
0061 GCACACAAAA CGGAATAATC AGGATGAGCT TTGACACCCT GGTGGGCACT GTGGGCGATC 
0121 ACTGCACCCT GGCCCTCTGC CTGATGATCG GATATGTTGT CTTCTACCGT ATCATTATCT 
0181 TCATTTACAT GAAGTTGAAG GTCTGTGACA TTCGGATGTG GGATGAACTG CAGCGAGCCA 
0241 AAGAGGATCC GGAGGCGCAT TTGGACAAAA AGTCCTACTA CCAGCCCGTC TCCACCGAGA 
0301 ATATCGATGT CGTGGACTCT GGCAAGAAGA AGAACAAGCC AACGACCCCG AAGATGATAA 
0361 GAACCATCAG CAATCCGCTG CTTATCGAAA GCGATCTGGC GCGCATTCAC ATCAAGCACG 
0421 AAACACGGCC TTTGGAAAGT GCCACCCTAC CCAGGCTGCA GCAGGCAATG GTCCACCCTA 
0481 GTCCGAGTCC CAGCTTGAGG  
 in silico PCR Fragment
0001 TCGAGCTGAT CACGGTGCTG GTGTATTGGG TGATCATCAC GCCCACCACC TACAAGTACT 
0061 GCACACAAAA CGGAATAATT AGGATGAGCT TTGACACCCT GGTTGGCACT GTGGGCGATC 
0121 ACTGCACCCT GGCCCTCTGC CTGATGATCG GATACGTTGT CTTCTACCGT ATCATTATCT 
0181 TCATTTACAT GAAGTTGAAG GTCTGTGACA TTCGGATGTG GGATGAACTG CAGCGAGCCA 
0241 AAGAGGATCC GGAGGCGCAT CTGGACAAAA AGTCCTACTA CCAGCCCGTC TCCACCGAGA 
0301 ATATCGATGT CGTGGACTCT GGCAAGAAGA AGAACAAGCC AACGACTCCG AAGATGATAA 
0361 GGACCATCAG CAATCCGCTG CTCATCGAAA GCGATCTGGC GCGCATTCAC ATCAAGCACG 
0421 AAACACGGCC TTTGGAAAGT GCCACCCTAC CCAGACTGCA GCAGGCAATG GTCCACCCTA 
0481 GTCCGAGTCC CAGCTTGAGG  
 Assemble Data

13116R-3.IR_full       1   TCGAGCTGATCACGGTGCTGGTGTATTGGGTGATCATCACGCCCACCACCTACAAGTACT 60
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
13116R-3.in silico     1   TCGAGCTGATCACGGTGCTGGTGTATTGGGTGATCATCACGCCCACCACCTACAAGTACT 60


13116R-3.IR_full       61  GCACACAAAACGGAATAATCAGGATGAGCTTTGACACCCTGGTGGGCACTGTGGGCGATC 120
                           ||||||||||||||||||| ||||||||||||||||||||||| ||||||||||||||||
13116R-3.in silico     61  GCACACAAAACGGAATAATTAGGATGAGCTTTGACACCCTGGTTGGCACTGTGGGCGATC 120


13116R-3.IR_full       121 ACTGCACCCTGGCCCTCTGCCTGATGATCGGATATGTTGTCTTCTACCGTATCATTATCT 180
                           |||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||
13116R-3.in silico     121 ACTGCACCCTGGCCCTCTGCCTGATGATCGGATACGTTGTCTTCTACCGTATCATTATCT 180


13116R-3.IR_full       181 TCATTTACATGAAGTTGAAGGTCTGTGACATTCGGATGTGGGATGAACTGCAGCGAGCCA 240
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
13116R-3.in silico     181 TCATTTACATGAAGTTGAAGGTCTGTGACATTCGGATGTGGGATGAACTGCAGCGAGCCA 240


13116R-3.IR_full       241 AAGAGGATCCGGAGGCGCATTTGGACAAAAAGTCCTACTACCAGCCCGTCTCCACCGAGA 300
                           |||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||
13116R-3.in silico     241 AAGAGGATCCGGAGGCGCATCTGGACAAAAAGTCCTACTACCAGCCCGTCTCCACCGAGA 300


13116R-3.IR_full       301 ATATCGATGTCGTGGACTCTGGCAAGAAGAAGAACAAGCCAACGACCCCGAAGATGATAA 360
                           |||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||
13116R-3.in silico     301 ATATCGATGTCGTGGACTCTGGCAAGAAGAAGAACAAGCCAACGACTCCGAAGATGATAA 360


13116R-3.IR_full       361 GAACCATCAGCAATCCGCTGCTTATCGAAAGCGATCTGGCGCGCATTCACATCAAGCACG 420
                           | |||||||||||||||||||| |||||||||||||||||||||||||||||||||||||
13116R-3.in silico     361 GGACCATCAGCAATCCGCTGCTCATCGAAAGCGATCTGGCGCGCATTCACATCAAGCACG 420


13116R-3.IR_full       421 AAACACGGCCTTTGGAAAGTGCCACCCTACCCAGGCTGCAGCAGGCAATGGTCCACCCTA 480
                           |||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||
13116R-3.in silico     421 AAACACGGCCTTTGGAAAGTGCCACCCTACCCAGACTGCAGCAGGCAATGGTCCACCCTA 480


13116R-3.IR_full       481 GTCCGAGTCCCAGCTTGAGG 500
                           ||||||||||||||||||||
13116R-3.in silico     481 GTCCGAGTCCCAGCTTGAGG 500

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_135462.2  CG13116-RA (CG13116), mRNA 
0.2   NM_080325.3  CG6450-RC (lva), mRNA 
0.2   NM_132004.2  CG4136-RA (CG4136), mRNA 
0   NM_136274.2  CG2225-RC, transcript variant C (CG2225), mRNA 
0   NM_206020.2  CG2225-RE, transcript variant E (CG2225), mRNA 
0   NM_165392.2  CG2225-RA, transcript variant A (CG2225), mRNA 
0   NM_165393.2  CG2225-RB, transcript variant B (CG2225), mRNA 
0   NM_001014497.1  CG2225-RF, transcript variant F (CG2225), mRNA 
0   NM_169810.1  CG18617-RA, transcript variant A (Vha100-2), mRNA 
0   NM_142465.1  CG18617-RB, transcript variant B (Vha100-2), mRNA 
0   NM_142354.1  CG4090-RA (CG4090), mRNA 
0   NM_136758.2  CG12309-RA (CG12309), mRNA 
0   NM_141178.3  CG12581-RA, transcript variant A (CG12581), mRNA 
0   NM_164313.1  CG12581-RB, transcript variant B (CG12581), mRNA 
0   NM_136864.2  CG13185-RA (CG13185), mRNA 
0   NM_136699.3  CG12128-RA, transcript variant A (CG12128), mRNA 
0   NM_206068.1  CG12128-RB, transcript variant B (CG12128), mRNA 
0   NM_058040.3  CG10372-RA (Faf), mRNA 
0   NM_137412.2  CG6406-RB, transcript variant B (CG6406), mRNA 
0   NM_166247.1  CG6406-RA, transcript variant A (CG6406), mRNA 
0   NM_139522.1  CG14964-RA (CG14964), mRNA 
0   NM_176583.1  CG11500-RA (Spase12), mRNA 
0   NM_143436.1  CG2006-RA (CG2006), mRNA 
0   NM_137983.3  CG9850-RA, transcript variant A (CG9850), mRNA 
0   NM_080250.2  CG6224-RA (dbo), mRNA 
0   NM_167921.1  CG12024-RB, transcript variant B (CG12024), mRNA 
0   NM_139413.2  CG12024-RA, transcript variant A (CG12024), mRNA 
0   NM_132006.1  CG17763-RA (CG17763), mRNA 
0   13  NM_131944.1  CG3546-RA (CG3546), mRNA 
0   NM_140150.2  CG32067-RC, transcript variant C (simj), mRNA 
 Wing Disc
GFP
Puc
Caspase
DAPI
Merge
Figure
JNK signal
N
 
DB
 
DC
 
DM
 
VM
 
VB
 
Caspase-3 signal
N
 
DB
 
DC
 
DM
 
VM
 
VB
 
Dcompartment   Penetrance
     

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.