National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock discarded request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 1309R-2 
 Symbol CG1309  Full Name CG1309 
 CG No CG1309  Old CG No CG1309 
 Synonyms CG1309 
 Accession No (Link to NCBI) NM_139623.2 
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
 Reference
[Please submit your publication]
Umetsu D, Dunst S, Dahmann C.
An RNA interference screen for genes required to shape the anteroposterior compartment boundary in Drosophila identifies the Eph receptor.
PLoS ONE (2014) 9(12) e114340 [ PubMed ID = 25473846 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgGGCCCCAACCTCTACATGGAA 
 Primer Seq. 3'
aatctagaggtaccAGGTAGGCGATGGCCTCACAG 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 GGCCCCAACC TCTACATGGA ATACCGCGGT GTGCCGGANG CCGCAGCGCA AGATGTACGA 
0061 GGCAGGTGCC GTGGAAAAGT TCGGGGAGCA GATTCTATCG ACGCTATCGG TTATGTGGTC 
0121 CGTGGGCTAT TATACTTCTC CGCTGCTCGT CACATTCCTA TACCGACGCG GCTACCTGGT 
0181 GACCGATTCC ATACCGACGC TGGCCAAGAT CACCACCAGC GTGGGCCTCA TCGTCATCCT 
0241 ATCGCTGGTG ATGCGCGGCT TGGGGGCVAA GCAATCGCGC TCCTACTCCA ACATGATTAA 
0301 GGCCCTCGTC CGAGCAAAGT CCTCCAAGGC ACCAGGAGAT GCCANACAGC GAGCTGCGTC 
0361 GCTTCGACAT CGAGTTCAAC GCTTGGCCGG TGGACTTTGA TGTGAAAGCT CTAACCGGTG 
0421 ATACCAAAAA GCCGGTGGTT ACGGCTAGAA GGCGGGAGCC CANTCCAGCT GGCGACACTG 
0481 CCCTGTGAGG CCATCGCCTA CCT 
 in silico PCR Fragment
0001 GGCCCCAACC TCTACATGGA ATACCGCGGT GTGCCGGA-G CCGCAGCGCA AGATGTACGA 
0061 GGCAGGTGCC GTGGAAAAGT TCGGGGAGCA GATTCTATCG ACGCTATCGG TTATGTGGTC 
0121 CGTGGGCTAT TATACTTCTC CGCTGCTCGT CACATTCCTA TACCGACGCG GCTACCTGGT 
0181 GACCGATTCC ATACCGACGC TGGCCAAGAT CACCACCAGC GTGGGCCTCA TCGTCATCCT 
0241 ATCGCTGGTG ATGCGCGGCC TGGGGCGCAA GCAATCGCGC TCCTACTCCA ACATGATTAA 
0301 GGCCCTCGTC CGAGCAAAGT CCTCCAAGGC ACCAGGAGAT GCCA-ACAGC GAGCTGCGTC 
0361 GCTTCGACAT CGAGTTCAAC GCTTGGCCGG TGGACTTTGA TGTGAAAGCT CTAACCGGTG 
0421 ATACCAAAAA GCCGGTGGTT ACGGCTAGAA GGCGGGAGCC CA-TCCAGCT GGCGACACTG 
0481 CCCTGTGAGG CCATCGCCTA CCT 
 Assemble Data

1309R-2.IR_full       1   GGCCCCAACCTCTACATGGAATACCGCGGTGTGCCGGANGCCGCAGCGCAAGATGTACGA 60
                          |||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||
1309R-2.in silico     1   GGCCCCAACCTCTACATGGAATACCGCGGTGTGCCGGA-GCCGCAGCGCAAGATGTACGA 60


1309R-2.IR_full       61  GGCAGGTGCCGTGGAAAAGTTCGGGGAGCAGATTCTATCGACGCTATCGGTTATGTGGTC 120
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
1309R-2.in silico     61  GGCAGGTGCCGTGGAAAAGTTCGGGGAGCAGATTCTATCGACGCTATCGGTTATGTGGTC 120


1309R-2.IR_full       121 CGTGGGCTATTATACTTCTCCGCTGCTCGTCACATTCCTATACCGACGCGGCTACCTGGT 180
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
1309R-2.in silico     121 CGTGGGCTATTATACTTCTCCGCTGCTCGTCACATTCCTATACCGACGCGGCTACCTGGT 180


1309R-2.IR_full       181 GACCGATTCCATACCGACGCTGGCCAAGATCACCACCAGCGTGGGCCTCATCGTCATCCT 240
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
1309R-2.in silico     181 GACCGATTCCATACCGACGCTGGCCAAGATCACCACCAGCGTGGGCCTCATCGTCATCCT 240


1309R-2.IR_full       241 ATCGCTGGTGATGCGCGGCTTGGGGGCVAAGCAATCGCGCTCCTACTCCAACATGATTAA 300
                          ||||||||||||||||||| |||||   ||||||||||||||||||||||||||||||||
1309R-2.in silico     241 ATCGCTGGTGATGCGCGGCCTGGGGCGCAAGCAATCGCGCTCCTACTCCAACATGATTAA 300


1309R-2.IR_full       301 GGCCCTCGTCCGAGCAAAGTCCTCCAAGGCACCAGGAGATGCCANACAGCGAGCTGCGTC 360
                          |||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||
1309R-2.in silico     301 GGCCCTCGTCCGAGCAAAGTCCTCCAAGGCACCAGGAGATGCCA-ACAGCGAGCTGCGTC 360


1309R-2.IR_full       361 GCTTCGACATCGAGTTCAACGCTTGGCCGGTGGACTTTGATGTGAAAGCTCTAACCGGTG 420
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
1309R-2.in silico     361 GCTTCGACATCGAGTTCAACGCTTGGCCGGTGGACTTTGATGTGAAAGCTCTAACCGGTG 420


1309R-2.IR_full       421 ATACCAAAAAGCCGGTGGTTACGGCTAGAAGGCGGGAGCCCANTCCAGCTGGCGACACTG 480
                          |||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||
1309R-2.in silico     421 ATACCAAAAAGCCGGTGGTTACGGCTAGAAGGCGGGAGCCCA-TCCAGCTGGCGACACTG 480


1309R-2.IR_full       481 CCCTGTGAGGCCATCGCCTACCT 503
                          |||||||||||||||||||||||
1309R-2.in silico     481 CCCTGTGAGGCCATCGCCTACCT 503

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_139623.2  CG1309-RA (CG1309), mRNA 
0.2   NM_130675.1  CG14416-RA (CG14416), mRNA 
0.2   NM_134747.2  CG5397-RA (CG5397), mRNA 
0   NM_058149.3  CG3352-RA (ft), mRNA 
0   NM_001014596.1  CG3263-RG, transcript variant G (Pka-R1), mRNA 
0   NM_001014595.1  CG3263-RH, transcript variant H (Pka-R1), mRNA 
0   NM_168875.2  CG3263-RA, transcript variant A (Pka-R1), mRNA 
0   NM_001014593.1  CG3263-RJ, transcript variant J (Pka-R1), mRNA 
0   NM_001014594.1  CG3263-RI, transcript variant I (Pka-R1), mRNA 
0   NM_001014598.1  CG3263-RE, transcript variant E (Pka-R1), mRNA 
0   NM_001014597.1  CG3263-RF, transcript variant F (Pka-R1), mRNA 
0   NM_079465.3  CG3263-RB, transcript variant B (Pka-R1), mRNA 
0   NM_168877.1  CG3263-RD, transcript variant D (Pka-R1), mRNA 
0   NM_138130.2  CG30420-RB, transcript variant B (Atf-2), mRNA 
0   NM_169833.1  CG7717-RB, transcript variant B (Mekk1), mRNA 
0   NM_142493.2  CG7717-RA, transcript variant A (Mekk1), mRNA 
0   NM_168876.4  CG3263-RC, transcript variant C (Pka-R1), mRNA 
0   NM_130619.2  CG4194-RA (CG4194), mRNA 
0   NM_057950.2  CG2054-RA (Cht2), mRNA 
0   NM_137815.2  CG3380-RA (Oatp58Dc), mRNA 
0   NM_078493.2  CG4206-RA (Mcm3), mRNA 
0   NM_001038961.1  CG15888-RB (CG15888), mRNA 
0   NM_001043311.1  CG15539-RB, transcript variant B (CG15539), mRNA 
0   NM_143547.2  CG15539-RA, transcript variant A (CG15539), mRNA 
0   NM_164364.2  CG4822-RB, transcript variant B (CG4822), mRNA 
0   NM_136348.2  CG7865-RA, transcript variant A (PNGase), mRNA 
0   NM_165454.1  CG7865-RB, transcript variant B (PNGase), mRNA 
0   NM_164725.1  CG9188-RE, transcript variant E (sip2), mRNA 
0   NM_164724.1  CG9188-RD, transcript variant D (sip2), mRNA 
0   NM_164723.1  CG9188-RC, transcript variant C (sip2), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.