National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 13078R-2 
 Symbol CG13078  Full Name CG13078 
 CG No CG13078  Old CG No CG13078 
 Synonyms CG13078 
 Accession No (Link to NCBI) NM_136145.1 
 Inserted Chr. lll 
 Insertional Mutation  semi-lethal 
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
 Reference
[Please submit your publication]
Umetsu D, Dunst S, Dahmann C.
An RNA interference screen for genes required to shape the anteroposterior compartment boundary in Drosophila identifies the Eph receptor.
PLoS ONE (2014) 9(12) e114340 [ PubMed ID = 25473846 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgGTGCTCCAGCATATAGAATCG 
 Primer Seq. 3'
aatctagaggtaccTATCCGTAAAACTGCGCCATC 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 GTGCTCCAGC ATATAGAATC GGCGCTATAT GTGATCAACC AGCTGTGCAT AGGATTCATC 
0061 ACCATTTGGA TCAGCTGGAC CTGTTTGCGC CAGGACCTNC TCAGGCATTC GCCTGCACGC 
0121 CTGGCTGGTT ACCTTCGGAT TTGTGTTCCT GATGGCCGAG GGAATGATGT GCTTCTACGA 
0181 CGGCAGTTGG CTAACTGTGC GTTACTCCCG GAATTACAAG ACTGCCTTTC ACGTGGTCCT 
0241 TCAGATCCTT GGGGGAGGCA TGGGCGTGGC CGGCTGTTTG ATTCAACTAA TACGTGACGA 
0301 TTGGTCAATC AGCGTCACGT TACATGCCCG CCTGGGTTTC GCCGCCTTCG TCCTGTGTCT 
0361 GATCTCATTG CTGAGTGGAC TGGTCGCCTT CCTGGCGAGA TGCCTGAGCA GGACCATCTC 
0421 ACCCTTGGTC AACAAGACCT TCCATGTGGT CCTCAGCTTC ACCGCCTTCG TGATCgCCAT 
0481 GATGGCGCAG TTTTACGGAT A 
 in silico PCR Fragment
0001 GTGCTCCAGC ATATAGAATC GGCGCTATAT GTGATCAACC AGCTGTGCAT AGGATTCGTC 
0061 ACCATTTGGA TCAGCTGGAC CTGCTTGCGC CAGGACCT-C TCGGGCATTC GCCTGCATGC 
0121 CTGGCTGGTT ACCTTCGGTT TTGTGTTCCT GATGGCCGAG GGAATGATGT GCTTCTACGA 
0181 CGGCAGTTGG CTAACTGTGC GTTACTCCCG GAATTACAAG ACTGCCTTTC ACGTGGTCCT 
0241 TCAGATCCTT GGGGGAGGCA TGGGCGTGGC CGGCTGTTTG ATTCAACTAA TACGTGACGA 
0301 TTGGTCAATC AGCGTCACGT TACATGCCCG CCTGGGTTTC GCCGCCTTCG TCCTGTGTCT 
0361 GATCTCATTG CTGAGTGGAC TGGTCGCCTT CCTGGCGAGA TGCCTGAGCA GGACCATCTC 
0421 ACCCTTGGTC AACAAGACCT TCCATGTGGT CCTCAGCTTC ACCGCCTTCG TGATCGCCAT 
0481 GATGGCGCAG TTTTACGGAT A 
 Assemble Data

13078R-2.IR_full       1   GTGCTCCAGCATATAGAATCGGCGCTATATGTGATCAACCAGCTGTGCATAGGATTCATC 60
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||
13078R-2.in silico     1   GTGCTCCAGCATATAGAATCGGCGCTATATGTGATCAACCAGCTGTGCATAGGATTCGTC 60


13078R-2.IR_full       61  ACCATTTGGATCAGCTGGACCTGTTTGCGCCAGGACCTNCTCAGGCATTCGCCTGCACGC 120
                           ||||||||||||||||||||||| |||||||||||||| ||| |||||||||||||| ||
13078R-2.in silico     61  ACCATTTGGATCAGCTGGACCTGCTTGCGCCAGGACCT-CTCGGGCATTCGCCTGCATGC 120


13078R-2.IR_full       121 CTGGCTGGTTACCTTCGGATTTGTGTTCCTGATGGCCGAGGGAATGATGTGCTTCTACGA 180
                           |||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||
13078R-2.in silico     121 CTGGCTGGTTACCTTCGGTTTTGTGTTCCTGATGGCCGAGGGAATGATGTGCTTCTACGA 180


13078R-2.IR_full       181 CGGCAGTTGGCTAACTGTGCGTTACTCCCGGAATTACAAGACTGCCTTTCACGTGGTCCT 240
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
13078R-2.in silico     181 CGGCAGTTGGCTAACTGTGCGTTACTCCCGGAATTACAAGACTGCCTTTCACGTGGTCCT 240


13078R-2.IR_full       241 TCAGATCCTTGGGGGAGGCATGGGCGTGGCCGGCTGTTTGATTCAACTAATACGTGACGA 300
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
13078R-2.in silico     241 TCAGATCCTTGGGGGAGGCATGGGCGTGGCCGGCTGTTTGATTCAACTAATACGTGACGA 300


13078R-2.IR_full       301 TTGGTCAATCAGCGTCACGTTACATGCCCGCCTGGGTTTCGCCGCCTTCGTCCTGTGTCT 360
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
13078R-2.in silico     301 TTGGTCAATCAGCGTCACGTTACATGCCCGCCTGGGTTTCGCCGCCTTCGTCCTGTGTCT 360


13078R-2.IR_full       361 GATCTCATTGCTGAGTGGACTGGTCGCCTTCCTGGCGAGATGCCTGAGCAGGACCATCTC 420
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
13078R-2.in silico     361 GATCTCATTGCTGAGTGGACTGGTCGCCTTCCTGGCGAGATGCCTGAGCAGGACCATCTC 420


13078R-2.IR_full       421 ACCCTTGGTCAACAAGACCTTCCATGTGGTCCTCAGCTTCACCGCCTTCGTGATCGCCAT 480
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
13078R-2.in silico     421 ACCCTTGGTCAACAAGACCTTCCATGTGGTCCTCAGCTTCACCGCCTTCGTGATCGCCAT 480


13078R-2.IR_full       481 GATGGCGCAGTTTTACGGATA 501
                           |||||||||||||||||||||
13078R-2.in silico     481 GATGGCGCAGTTTTACGGATA 501

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_136145.1  CG13078-RA (CG13078), mRNA 
0   NM_143213.2  CG12290-RA (CG12290), mRNA 
0   NM_169828.1  CG31229-RA (CG31229), mRNA 
0   NM_078900.2  CG12754-RA (Or42b), mRNA 
0   NM_165794.2  CG11895-RA (stan), mRNA 
0   NM_001015116.1  CG40245-PA.3 (CG40245), mRNA 
0   NM_141331.2  CG1100-RA (Rpn5), mRNA 
0   NM_133143.1  CG8002-RA (rictor), mRNA 
0   NM_135733.1  CG15485-RA (CG15485), mRNA 
0   NM_139464.2  CG32306-RB, transcript variant B (CG32306), mRNA 
0   NM_206242.1  CG32306-RD, transcript variant D (CG32306), mRNA 
0   NM_176556.1  CG33106-RA, transcript variant A (mask), mRNA 
0   NM_176106.1  CG33141-RA, transcript variant A (sns), mRNA 
0   NM_001043067.1  CG33141-RB, transcript variant B (sns), mRNA 
0   NM_176557.1  CG33106-RB, transcript variant B (mask), mRNA 
0   NM_136865.1  CG13190-RA (CG13190), mRNA 
0   NM_166896.1  CG11491-RB, transcript variant B (br), mRNA 
0   NM_166897.1  CG11491-RC, transcript variant C (br), mRNA 
0   20  NM_136146.2  CG13077-RA (CG13077), mRNA 
0   NM_079747.2  CG5394-RA, transcript variant A (Aats-glupro), mRNA 
0   NM_170103.1  CG5394-RB, transcript variant B (Aats-glupro), mRNA 
0   NM_001014714.1  CG33513-RC, transcript variant C (Nmdar2), mRNA 
0   NM_143772.3  CG17753-RA (CCS), mRNA 
0   NM_137481.2  CG17524-RA (GstE3), mRNA 
0   NM_206480.2  CG17207-RA (CG17207), mRNA 
0   11  NM_167942.1  CG1275-RA, transcript variant A (CG1275), mRNA 
0   11  NM_167941.1  CG1275-RC, transcript variant C (CG1275), mRNA 
0   11  NM_206241.1  CG1275-RD, transcript variant D (CG1275), mRNA 
0   11  NM_139446.2  CG1275-RB, transcript variant B (CG1275), mRNA 
0   NM_136702.2  CG18445-RA (CG18445), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.