National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 13016R-1 
 Symbol CG13016  Full Name CG13016 
 CG No CG13016  Old CG No CG13016 
 Synonyms CG13016 
 Accession No (Link to NCBI) NM_137085.2 
 Inserted Chr. lll 
 Insertional Mutation  lethal 
 Phenotype induced by Act5C-GAL4 at 28 degrees pupal lethal 
 Map Viewer
 Reference
[Please submit your publication]
Umetsu D, Dunst S, Dahmann C.
An RNA interference screen for genes required to shape the anteroposterior compartment boundary in Drosophila identifies the Eph receptor.
PLoS ONE (2014) 9(12) e114340 [ PubMed ID = 25473846 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgAAACACATGATTCCTTCGCCC 
 Primer Seq. 3'
aatctagaggtaccAAGCTGGAAGCCGAAGATCAA 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 AAACACATGA TTCCTTCGCC CACCTGCTGG CAACCAAGCA GGGCCAATCC CAGACACCGG 
0061 CCACAGCGAT GCCCAAACAC ATTCCCTTCC CGGAGCACGC CACCACATCC GAGTGGCTCA 
0121 GCGAACTCAT CATGTGCGCC TTTACCATGG GTTCGGCCAT CGTACAGTTC ATCAACATCT 
0181 ATAGAACCAA CTGGTNGGCT GCCACAGGCG CACACCAGGC ATATGGTGAA CATCGAGCTG 
0241 ATCGATCCTT ATCTTCGCTA TCTACTGCTC ATACTCAATA CGCGGAGACT GATTTACTGC 
0301 TTGCTGCTGG TGAAGATCAG GAAAAGAAAC GAGAAGAGCC GGCATCTTAT CCGACTGGGA 
0361 ATCAAGTACG GATTTGGAGG CCTTGTTCAG CTATCCTTGG GTTTCTGCGC CATGAAGCTA 
0421 TACCAGAAGC ACACATACAT ACTCCTTCTC TTCTTATTCT ATCCTGTGGT CATCTACCTG 
0481 TTGATCTTCG GCTTCCAGCT T 
 in silico PCR Fragment
0001 AAACACATGA TTCCTTCGCC CACCTGCTGG CAACCAAGCA GGGCCAATCC CAGACACCGG 
0061 CCACAGCGAT GCCCAAACAC ATTCCCTTCC CGGAGCACGC CACCACATCC GAGTGGCTCA 
0121 GCGAACTCAT CATGTGCGCC TTTACCATGG GTTCGGCCAT CGTACAGTTC ATCAACATCT 
0181 ATAGAACCAA CTGGT-GGCT GCCACAGGCG CACACCAGGC ATATGGTGAA CATCGAGCTG 
0241 ATCGATCCTT ATCTTCGCTA TCTACTGCTC ATACTCAATA CGCGGAGACT GATTTACTGC 
0301 TTGCTGCTGG TGAAGATCAG GAAAAGAAAC GAGAAGAGCC GGCATCTTAT CCGACTGGGA 
0361 ATCAAGTACG GATTTGGAGG CCTTGTTCAG CTATCCTTGG GTTTCTGCGC CATGAAGCTA 
0421 TACCAGAAGC ACACATACAT ACTCCTTCTC TTCTTATTCT ATCCTGTGGT CATCTACCTG 
0481 TTGATCTTCG GCTTCCAGCT T 
 Assemble Data

13016R-1.IR_full       1   AAACACATGATTCCTTCGCCCACCTGCTGGCAACCAAGCAGGGCCAATCCCAGACACCGG 60
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
13016R-1.in silico     1   AAACACATGATTCCTTCGCCCACCTGCTGGCAACCAAGCAGGGCCAATCCCAGACACCGG 60


13016R-1.IR_full       61  CCACAGCGATGCCCAAACACATTCCCTTCCCGGAGCACGCCACCACATCCGAGTGGCTCA 120
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
13016R-1.in silico     61  CCACAGCGATGCCCAAACACATTCCCTTCCCGGAGCACGCCACCACATCCGAGTGGCTCA 120


13016R-1.IR_full       121 GCGAACTCATCATGTGCGCCTTTACCATGGGTTCGGCCATCGTACAGTTCATCAACATCT 180
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
13016R-1.in silico     121 GCGAACTCATCATGTGCGCCTTTACCATGGGTTCGGCCATCGTACAGTTCATCAACATCT 180


13016R-1.IR_full       181 ATAGAACCAACTGGTNGGCTGCCACAGGCGCACACCAGGCATATGGTGAACATCGAGCTG 240
                           ||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||
13016R-1.in silico     181 ATAGAACCAACTGGT-GGCTGCCACAGGCGCACACCAGGCATATGGTGAACATCGAGCTG 240


13016R-1.IR_full       241 ATCGATCCTTATCTTCGCTATCTACTGCTCATACTCAATACGCGGAGACTGATTTACTGC 300
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
13016R-1.in silico     241 ATCGATCCTTATCTTCGCTATCTACTGCTCATACTCAATACGCGGAGACTGATTTACTGC 300


13016R-1.IR_full       301 TTGCTGCTGGTGAAGATCAGGAAAAGAAACGAGAAGAGCCGGCATCTTATCCGACTGGGA 360
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
13016R-1.in silico     301 TTGCTGCTGGTGAAGATCAGGAAAAGAAACGAGAAGAGCCGGCATCTTATCCGACTGGGA 360


13016R-1.IR_full       361 ATCAAGTACGGATTTGGAGGCCTTGTTCAGCTATCCTTGGGTTTCTGCGCCATGAAGCTA 420
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
13016R-1.in silico     361 ATCAAGTACGGATTTGGAGGCCTTGTTCAGCTATCCTTGGGTTTCTGCGCCATGAAGCTA 420


13016R-1.IR_full       421 TACCAGAAGCACACATACATACTCCTTCTCTTCTTATTCTATCCTGTGGTCATCTACCTG 480
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
13016R-1.in silico     421 TACCAGAAGCACACATACATACTCCTTCTCTTCTTATTCTATCCTGTGGTCATCTACCTG 480


13016R-1.IR_full       481 TTGATCTTCGGCTTCCAGCTT 501
                           |||||||||||||||||||||
13016R-1.in silico     481 TTGATCTTCGGCTTCCAGCTT 501

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_137085.2  CG13016-RA (CG13016), mRNA 
0   15  NM_137093.4  CG30069-RA (CG30069), mRNA 
0   NM_132004.2  CG4136-RA (CG4136), mRNA 
0   NM_137971.2  CG5428-RA (CG5428), mRNA 
0   NM_134588.1  CG1503-RA (CG1503), mRNA 
0   NM_165206.1  CG31744-RA (Gr36b), mRNA 
0   11  NM_136132.4  CG10084-RA, transcript variant A (swm), mRNA 
0   11  NM_165304.1  CG10084-RB, transcript variant B (swm), mRNA 
0   12  NM_132522.2  CG32662-RA (CG32662), mRNA 
0   NM_140799.1  CG6885-RA (CG6885), mRNA 
0   NM_164504.1  CG3119-RB, transcript variant B (CG3119), mRNA 
0   NM_134873.1  CG3119-RA, transcript variant A (CG3119), mRNA 
0   NM_167267.1  CG1453-RB, transcript variant B (Klp10A), mRNA 
0   NM_167268.1  CG1453-RC, transcript variant C (Klp10A), mRNA 
0   NM_167270.1  CG1453-RE, transcript variant E (Klp10A), mRNA 
0   NM_167269.1  CG1453-RD, transcript variant D (Klp10A), mRNA 
0   NM_132459.2  CG1453-RA, transcript variant A (Klp10A), mRNA 
0   NM_136784.3  CG12942-RA (CG12942), mRNA 
0   NM_139541.1  CG12017-RA (CG12017), mRNA 
0   NM_079635.2  CG6384-RA, transcript variant A (Cp190), mRNA 
0   NM_169632.1  CG6384-RB, transcript variant B (Cp190), mRNA 
0   NM_168102.1  CG32239-RA (Gef64C), mRNA 
0   NM_168478.1  CG32094-RA (CG32094), mRNA 
0   NM_132481.1  CG1738-RA (CG1738), mRNA 
0   NM_001015505.1  CG17866-PA.3 (CG17866), mRNA 
0   NM_135925.2  CG13243-RA (CG13243), mRNA 
0   NM_168788.2  CG9655-RB, transcript variant B (nes), mRNA 
0   NM_176349.1  CG9655-RC, transcript variant C (nes), mRNA 
0   NM_079433.2  CG9655-RA, transcript variant A (nes), mRNA 
0   NM_130507.2  CG7359-RA (CG7359), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.