National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 12984R-3 
 Symbol CG12984  Full Name CG12984 
 CG No CG12984  Old CG No CG12984 
 Synonyms CG12984 
 Accession No (Link to NCBI) NM_141019.1 
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees semi-lethal 
 Map Viewer
[Please submit your publication]
Umemori M, Habara O, Iwata T, Maeda K, Nishinoue K, Okabe A, Takemura M, Takahashi K, Saigo K, Ueda R, Adachi-Yamada T.
RNAi-mediated knockdown showing impaired cell survival in Drosophila wing imaginal disc.
Gene Regul Syst Bio (2009) 3 11-20 [ PubMed ID = 19838331 ] [ RRC reference ]  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
 Primer Seq. 3'
 Predicted Fragment Size
 IR fragment full Seq
 in silico PCR Fragment
 Assemble Data

                           ||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     1   AATGT-GGACAAAGCCAGAGACGAGATGATTGAGATGTCCGAGCAGGTGTGGAAGGATGC 60

                           | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     61  G-GAGCAGTGGCAAAGAGGTATCCACAATGGTCAGGCGGTCATGAAGCAGATCAAGGCCA 120

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     121 TAAATCTTAAGCTCTTCAGCACCGAGAATAGGCTGAACAACGCGGACTCGCGTAAGGAGC 180

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     181 TCCAGGCCACAGGGAAACGGATCAACCACTTGTACCAATGCCTCCAACGACCTCTCGCCA 240

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     241 CGATAGGCAACATTTTAAGGACCCTGACCGGTATCAGGGACAACACTGCCAGGATGTTGA 300

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     301 GCCGCTTGACCATATTCTTGGACGATGAAACACTGGCGAAGCACAGAATACGGCCCAAGC 360

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     361 TCGAGAGTTCCAAGCTTCTGAAGATGCTGCAGTTCCTAAGCCACCGTTACGATACCGAAT 420

                           |||||||||||||||||||||||||| silico     421 GGGAGGTCAAGGAAATGGTCGTGAGT 446

 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   426  NM_141019.1  CG12984-RA (CG12984), mRNA 
0   NM_206576.1  CG6095-RB, transcript variant B (CG6095), mRNA 
0   NM_143197.1  CG6095-RA, transcript variant A (CG6095), mRNA 
0   12  NM_166015.1  CG18076-RG, transcript variant G (shot), mRNA 
0   12  NM_166016.1  CG18076-RB, transcript variant B (shot), mRNA 
0   NM_166017.1  CG18076-RE, transcript variant E (shot), mRNA 
0   NM_079009.2  CG18076-RA, transcript variant A (shot), mRNA 
0   NM_166018.1  CG18076-RC, transcript variant C (shot), mRNA 
0   NM_166019.1  CG18076-RH, transcript variant H (shot), mRNA 
0   NM_169197.2  CG31187-RA (CG31187), mRNA 
0   NM_057470.3  CG9191-RA (Klp61F), mRNA 
0   NM_057333.3  CG5711-RA (Arr1), mRNA 
0   NM_176324.1  CG10975-RB, transcript variant B (Ptp69D), mRNA 
0   NM_079202.2  CG7452-RA (Syx17), mRNA 
0   NM_079324.2  CG10975-RA, transcript variant A (Ptp69D), mRNA 
0   NM_165932.1  CG8785-RB, transcript variant B (CG8785), mRNA 
0   NM_136960.2  CG8785-RA, transcript variant A (CG8785), mRNA 
0   NM_135310.2  CG7115-RB, transcript variant B (CG7115), mRNA 
0   NM_164774.1  CG7115-RA, transcript variant A (CG7115), mRNA 
0   15  NM_165139.1  CG4793-RC, transcript variant C (CG4793), mRNA 
0   NM_136560.2  CG8584-RA (CG8584), mRNA 
0   NM_165089.2  CG3479-RA, transcript variant A (osp), mRNA 
0   NM_078843.4  CG3479-RB, transcript variant B (osp), mRNA 
0   NM_079700.1  CG3723-RA (Dhc93AB), mRNA 
0   NM_139710.1  CG10629-RA (CG10629), mRNA 
0   NM_135270.1  CG5177-RA (CG5177), mRNA 
0   NM_079590.2  CG6644-RA (Ugt35a), mRNA 
0   NM_058088.3  CG8730-RA (drosha), mRNA 
0   NM_140764.1  CG5506-RA (CG5506), mRNA 
0   NM_134937.2  CG3246-RA (CG3246), mRNA 
 Wing Disc
JNK signal
Caspase-3 signal
Dcompartment   Penetrance

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.