National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock discarded request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 12984R-1 
 Symbol CG12984  Full Name CG12984 
 CG No CG12984  Old CG No CG12984 
 Synonyms CG12984 
 Accession No (Link to NCBI) NM_141019.1 
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees viable 
 Map Viewer
 Reference
[Please submit your publication]
 
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgAATGTGGACAAAGCCAGAGAC 
 Primer Seq. 3'
aatctagaggtaccACTCACGACCATTTCCTTGAC 
 Predicted Fragment Size
444 
 IR fragment full Seq
0001 AATGTGGGAC AAAGCCAGAG ACGAGATGAT TGAGATGTCC GAGCAGGTGT GGAAGGATGC 
0061 GCGAGCAGTG GCAAAGAGGT ATCCACAATG GTCAGGCGGT CATGAAGCAG ATCAAGGCCA 
0121 TAAATCTTAA GCTCTTCAGC ACCGAGAATA GGCTGAACAA CGCGGACTCG CGTAAGGAGC 
0181 TCCAGGCCAC AGGGAAACGG ATCAACCACT TGTACCAATG CCTCCAACGA CCTCTCGCCA 
0241 CGATAGGCAA CATTTTAAGG ACCCTGACCG GTATCAGGGA CAACACTGCC AGGATGTTGA 
0301 GCCGCTTGAC CATATTCTTG GACGATGAAA CACTGGCGAA GCACAGAATA CGGCCCAAGC 
0361 TCGAGAGTTC CAAGCTTCTG AAGATGCTGC AGTTCCTAAG CCACCGTTAC GATACCGAAT 
0421 GGGAGGTCAA GGAAATGGTC GTGAGT 
 in silico PCR Fragment
0001 AATGT-GGAC AAAGCCAGAG ACGAGATGAT TGAGATGTCC GAGCAGGTGT GGAAGGATGC 
0061 G-GAGCAGTG GCAAAGAGGT ATCCACAATG GTCAGGCGGT CATGAAGCAG ATCAAGGCCA 
0121 TAAATCTTAA GCTCTTCAGC ACCGAGAATA GGCTGAACAA CGCGGACTCG CGTAAGGAGC 
0181 TCCAGGCCAC AGGGAAACGG ATCAACCACT TGTACCAATG CCTCCAACGA CCTCTCGCCA 
0241 CGATAGGCAA CATTTTAAGG ACCCTGACCG GTATCAGGGA CAACACTGCC AGGATGTTGA 
0301 GCCGCTTGAC CATATTCTTG GACGATGAAA CACTGGCGAA GCACAGAATA CGGCCCAAGC 
0361 TCGAGAGTTC CAAGCTTCTG AAGATGCTGC AGTTCCTAAG CCACCGTTAC GATACCGAAT 
0421 GGGAGGTCAA GGAAATGGTC GTGAGT 
 Assemble Data

12984R-1.IR_full       1   AATGTGGGACAAAGCCAGAGACGAGATGATTGAGATGTCCGAGCAGGTGTGGAAGGATGC 60
                           ||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||
12984R-1.in silico     1   AATGT-GGACAAAGCCAGAGACGAGATGATTGAGATGTCCGAGCAGGTGTGGAAGGATGC 60


12984R-1.IR_full       61  GCGAGCAGTGGCAAAGAGGTATCCACAATGGTCAGGCGGTCATGAAGCAGATCAAGGCCA 120
                           | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
12984R-1.in silico     61  G-GAGCAGTGGCAAAGAGGTATCCACAATGGTCAGGCGGTCATGAAGCAGATCAAGGCCA 120


12984R-1.IR_full       121 TAAATCTTAAGCTCTTCAGCACCGAGAATAGGCTGAACAACGCGGACTCGCGTAAGGAGC 180
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
12984R-1.in silico     121 TAAATCTTAAGCTCTTCAGCACCGAGAATAGGCTGAACAACGCGGACTCGCGTAAGGAGC 180


12984R-1.IR_full       181 TCCAGGCCACAGGGAAACGGATCAACCACTTGTACCAATGCCTCCAACGACCTCTCGCCA 240
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
12984R-1.in silico     181 TCCAGGCCACAGGGAAACGGATCAACCACTTGTACCAATGCCTCCAACGACCTCTCGCCA 240


12984R-1.IR_full       241 CGATAGGCAACATTTTAAGGACCCTGACCGGTATCAGGGACAACACTGCCAGGATGTTGA 300
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
12984R-1.in silico     241 CGATAGGCAACATTTTAAGGACCCTGACCGGTATCAGGGACAACACTGCCAGGATGTTGA 300


12984R-1.IR_full       301 GCCGCTTGACCATATTCTTGGACGATGAAACACTGGCGAAGCACAGAATACGGCCCAAGC 360
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
12984R-1.in silico     301 GCCGCTTGACCATATTCTTGGACGATGAAACACTGGCGAAGCACAGAATACGGCCCAAGC 360


12984R-1.IR_full       361 TCGAGAGTTCCAAGCTTCTGAAGATGCTGCAGTTCCTAAGCCACCGTTACGATACCGAAT 420
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
12984R-1.in silico     361 TCGAGAGTTCCAAGCTTCTGAAGATGCTGCAGTTCCTAAGCCACCGTTACGATACCGAAT 420


12984R-1.IR_full       421 GGGAGGTCAAGGAAATGGTCGTGAGT 446
                           ||||||||||||||||||||||||||
12984R-1.in silico     421 GGGAGGTCAAGGAAATGGTCGTGAGT 446

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   426  NM_141019.1  CG12984-RA (CG12984), mRNA 
0   NM_206576.1  CG6095-RB, transcript variant B (CG6095), mRNA 
0   NM_143197.1  CG6095-RA, transcript variant A (CG6095), mRNA 
0   12  NM_166015.1  CG18076-RG, transcript variant G (shot), mRNA 
0   12  NM_166016.1  CG18076-RB, transcript variant B (shot), mRNA 
0   NM_166017.1  CG18076-RE, transcript variant E (shot), mRNA 
0   NM_079009.2  CG18076-RA, transcript variant A (shot), mRNA 
0   NM_166018.1  CG18076-RC, transcript variant C (shot), mRNA 
0   NM_166019.1  CG18076-RH, transcript variant H (shot), mRNA 
0   NM_169197.2  CG31187-RA (CG31187), mRNA 
0   NM_057470.3  CG9191-RA (Klp61F), mRNA 
0   NM_057333.3  CG5711-RA (Arr1), mRNA 
0   NM_176324.1  CG10975-RB, transcript variant B (Ptp69D), mRNA 
0   NM_079202.2  CG7452-RA (Syx17), mRNA 
0   NM_079324.2  CG10975-RA, transcript variant A (Ptp69D), mRNA 
0   NM_165932.1  CG8785-RB, transcript variant B (CG8785), mRNA 
0   NM_136960.2  CG8785-RA, transcript variant A (CG8785), mRNA 
0   NM_135310.2  CG7115-RB, transcript variant B (CG7115), mRNA 
0   NM_164774.1  CG7115-RA, transcript variant A (CG7115), mRNA 
0   15  NM_165139.1  CG4793-RC, transcript variant C (CG4793), mRNA 
0   NM_136560.2  CG8584-RA (CG8584), mRNA 
0   NM_165089.2  CG3479-RA, transcript variant A (osp), mRNA 
0   NM_078843.4  CG3479-RB, transcript variant B (osp), mRNA 
0   NM_079700.1  CG3723-RA (Dhc93AB), mRNA 
0   NM_139710.1  CG10629-RA (CG10629), mRNA 
0   NM_135270.1  CG5177-RA (CG5177), mRNA 
0   NM_079590.2  CG6644-RA (Ugt35a), mRNA 
0   NM_058088.3  CG8730-RA (drosha), mRNA 
0   NM_140764.1  CG5506-RA (CG5506), mRNA 
0   NM_134937.2  CG3246-RA (CG3246), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.