National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 12983R-4 
 Symbol CG12983  Full Name CG12983 
 CG No CG12983  Old CG No CG12983 
 Synonyms bs29a07.y1, NEST:bs29a07, CG12983 
 Accession No (Link to NCBI) NM_141017.2 
 Inserted Chr. ll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees pupal semi-lethal 
 Map Viewer
 Reference
[Please submit your publication]
Umemori M, Habara O, Iwata T, Maeda K, Nishinoue K, Okabe A, Takemura M, Takahashi K, Saigo K, Ueda R, Adachi-Yamada T.
RNAi-mediated knockdown showing impaired cell survival in Drosophila wing imaginal disc.
Gene Regul Syst Bio (2009) 3 11-20 [ PubMed ID = 19838331 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgAGCTTCCAGCTGGCATGTTTC 
 Primer Seq. 3'
aatctagaggtaccTTTCGCTTTCGACGGCGTTTC 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 AGCTTCCAGC TGGCATGTTT CCTGANCCAC GCAAGATATT TCTGGAGCAC GAAAAACGAG 
0061 ATTGCACTGA CTTCTTTAAT AGATACTTCC ATCCAGGCAA TATAAATTTA CTGCCCTCAG 
0121 AGGTGAACCT GCGTCGTTTC ATCATCTTAG GTGGCATAGT CTCGTTGGTC TTTGTGGGAA 
0181 AAGCCAAACA TGCCTCTTAT GAGAAATTTA ATATAACGCT GCATGAGGAT GGACGTGTAC 
0241 TGCGGAAATC TCTAAATATT TTGGACGAAT CGAGTACGGA GGAATGTAGT ATGCAGCCTA 
0301 GCAAATTGGA TATCGGCACA GATATAATGA GGGATACCGA AGTTGGGGAA GCCTCTAAAA 
0361 TTCCACTGCA CTTGGAACCA GATGAGCTGC CTTATTACTT TCTCACCTTC AAGGTGCCCA 
0421 ATCATTTGTG CTTGTGGGGA GAACCCATTG TTTGCCAATT CTTCGAGAGC GAAATCGAAG 
0481 AAACGCCGTC GAAAGCGAAA  
 in silico PCR Fragment
0001 AGCTTCCAGC TGGCATGTTT CCTGATCCAC GCAAGATATT TCTGGAGCAC GAAAAACGAG 
0061 ATTGCACTGA CTTCTTTAAT AGATACTTCC ATCCAGGCAA TATAAATTTA CTGCCCTCAG 
0121 AGGTGAACCT GCGTCGTTTC ATCATCTTAG GTGGCATAGT CTCGTTGGTC TTTGTGGGAA 
0181 AAGCCAAACA TGCCTCTTAT GAGAAATTTA ATATAACGCT GCATGAGGAT GGACGTGTAC 
0241 TGCGGAAATC TCTAAATATT TTGGACGAAT CGAGTACGGA GGAATGTAGT ATGCAGCCTA 
0301 GCAAATTGGA TATCGGCACA GATATAATGA GGGATACCGA AGTTGGGGAA GCCTCTAAAA 
0361 TTCCACTGCA CTTGGAACCA GATGAGCTGC CTTATTACTT TCTCACCTTC AAGGTGCCCA 
0421 ATCATTTGTG CTTGTGGGGA GAACCCATTG TTTGCCAATT CTTCGAGAGC GAAATCGAAG 
0481 AAACGCCGTC GAAAGCGAAA  
 Assemble Data

12983R-4.IR_full       1   AGCTTCCAGCTGGCATGTTTCCTGANCCACGCAAGATATTTCTGGAGCACGAAAAACGAG 60
                           ||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||
12983R-4.in silico     1   AGCTTCCAGCTGGCATGTTTCCTGATCCACGCAAGATATTTCTGGAGCACGAAAAACGAG 60


12983R-4.IR_full       61  ATTGCACTGACTTCTTTAATAGATACTTCCATCCAGGCAATATAAATTTACTGCCCTCAG 120
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
12983R-4.in silico     61  ATTGCACTGACTTCTTTAATAGATACTTCCATCCAGGCAATATAAATTTACTGCCCTCAG 120


12983R-4.IR_full       121 AGGTGAACCTGCGTCGTTTCATCATCTTAGGTGGCATAGTCTCGTTGGTCTTTGTGGGAA 180
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
12983R-4.in silico     121 AGGTGAACCTGCGTCGTTTCATCATCTTAGGTGGCATAGTCTCGTTGGTCTTTGTGGGAA 180


12983R-4.IR_full       181 AAGCCAAACATGCCTCTTATGAGAAATTTAATATAACGCTGCATGAGGATGGACGTGTAC 240
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
12983R-4.in silico     181 AAGCCAAACATGCCTCTTATGAGAAATTTAATATAACGCTGCATGAGGATGGACGTGTAC 240


12983R-4.IR_full       241 TGCGGAAATCTCTAAATATTTTGGACGAATCGAGTACGGAGGAATGTAGTATGCAGCCTA 300
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
12983R-4.in silico     241 TGCGGAAATCTCTAAATATTTTGGACGAATCGAGTACGGAGGAATGTAGTATGCAGCCTA 300


12983R-4.IR_full       301 GCAAATTGGATATCGGCACAGATATAATGAGGGATACCGAAGTTGGGGAAGCCTCTAAAA 360
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
12983R-4.in silico     301 GCAAATTGGATATCGGCACAGATATAATGAGGGATACCGAAGTTGGGGAAGCCTCTAAAA 360


12983R-4.IR_full       361 TTCCACTGCACTTGGAACCAGATGAGCTGCCTTATTACTTTCTCACCTTCAAGGTGCCCA 420
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
12983R-4.in silico     361 TTCCACTGCACTTGGAACCAGATGAGCTGCCTTATTACTTTCTCACCTTCAAGGTGCCCA 420


12983R-4.IR_full       421 ATCATTTGTGCTTGTGGGGAGAACCCATTGTTTGCCAATTCTTCGAGAGCGAAATCGAAG 480
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
12983R-4.in silico     421 ATCATTTGTGCTTGTGGGGAGAACCCATTGTTTGCCAATTCTTCGAGAGCGAAATCGAAG 480


12983R-4.IR_full       481 AAACGCCGTCGAAAGCGAAA 500
                           ||||||||||||||||||||
12983R-4.in silico     481 AAACGCCGTCGAAAGCGAAA 500

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_141017.2  CG12983-RA (CG12983), mRNA 
0   NM_080421.3  CG18730-RA (Amy-p), mRNA 
0   NM_079336.2  CG7002-RA (Hml), mRNA 
0   NM_079044.1  CG17876-RA (Amy-d), mRNA 
0   NM_166765.1  CG11533-RC, transcript variant C (Asator), mRNA 
0   NM_166766.1  CG11533-RB, transcript variant B (Asator), mRNA 
0   NM_143667.1  CG11533-RA, transcript variant A (Asator), mRNA 
0   NM_170449.2  CG31038-RD, transcript variant D (CG31038), mRNA 
0   NM_170448.1  CG31038-RB, transcript variant B (CG31038), mRNA 
0   NM_142982.2  CG13611-RA (CG13611), mRNA 
0   16  NM_144448.2  CG1915-RC, transcript variant C (sls), mRNA 
0   NM_137809.1  CG3292-RA (CG3292), mRNA 
0   NM_057760.4  CG12245-RA (gcm), mRNA 
0   NM_132599.1  CG12717-RA (CG12717), mRNA 
0   NM_079275.2  CG4463-RA (Hsp23), mRNA 
0   NM_169084.1  CG31546-RA (CG31546), mRNA 
0   NM_137730.2  CG30387-RA, transcript variant A (CG30387), mRNA 
0   NM_080142.2  CG1925-RA (mus205), mRNA 
0   NM_136595.1  CG13744-RA (CG13744), mRNA 
0   NM_001043084.1  CG34123-RD, transcript variant D (CG34123), mRNA 
0   NM_166441.2  CG30387-RB, transcript variant B (CG30387), mRNA 
0   NM_166442.2  CG30387-RC, transcript variant C (CG30387), mRNA 
0   NM_141553.1  CG9770-RA (CG9770), mRNA 
0   NM_165324.1  CG10076-RD, transcript variant D (spir), mRNA 
0   NM_165019.2  CG5792-RB, transcript variant B (CG5792), mRNA 
0   12  NM_205875.1  CG32019-RE, transcript variant E (bt), mRNA 
0   12  NM_205876.1  CG32019-RC, transcript variant C (bt), mRNA 
0   12  NM_205877.1  CG32019-RD, transcript variant D (bt), mRNA 
0   12  NM_166790.2  CG32019-RA, transcript variant A (bt), mRNA 
0   11  NM_206404.1  CG33287-RA (CG33287), mRNA 
 Wing Disc
GFP
Puc
Caspase
DAPI
Merge
Figure
JNK signal
N
 
DB
+- 
DC
+- 
DM
 
VM
 
VB
 
Caspase-3 signal
N
 
DB
DC
DM
VM
 
VB
 
Dcompartment   Penetrance
     

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.