National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 12833R-1 
 Symbol esn  Full Name espinas 
 CG No CG12833  Old CG No CG12833 
 Synonyms CG12833, esn 
 Accession No (Link to NCBI) NM_165507.1 
 Inserted Chr. lll 
 Insertional Mutation  lethal 
 Phenotype induced by Act5C-GAL4 at 28 degrees viable 
 Map Viewer
 Reference
[Please submit your publication]
 
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgGCCCAGCAGCAGCTACTACAC 
 Primer Seq. 3'
aatctagaggtaccAGGGCACTTTGTCGTCTGGCA 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 GCCCATGCAG CAGCTACCAC ACGCAAACCG AAAGCGAGCT GCTGCAGATT GAGGCGGGCG 
0061 GCACGGGCCT GACCTTCGCC TCCCACTCGC AACGTCCCGA ATCGGCGATC AGTCAGGTGG 
0121 CATCCACCGC CCACCTGGAC GTGCCCTCgG CCGCCTCCAG CGGCAGCGNG GGGCAGTTGC 
0181 TAGTCAGTGG GGGAAGCGGC GGAGCTCCGG AATCCGCGGG TCGATTTGTG TCCCCGCTGC 
0241 AGcGCCGCCA CTGCCAGCCG CCCAGCCACC TGCCGCTGAA CTCGGTGGCC TCCCCGCTCC 
0301 GCACCGCCAG CTACAAGTCG GCGGCGGCGG TCGNTGGTCA TGGCTTCCAC CACAGCCATC 
0361 ACCAGCAGCT GGACTTCCAG CGGAACTCGC AGTCGGACGA CGACAGCGGC TGTGCCCTCG 
0421 AGGAGTACAC TTGGGTGCCG CCGGGTCTGC GGCCCGATCA GGTCCGTTTG TACTTCAGTC 
0481 AACTGCCAGA CGACAAAGTG CCCT 
 in silico PCR Fragment
0001 GCCCA-GCAG CAGCTACTAC ACGCAAACCG AAAGCGAGCT GCTGCAGATT GAGGCGGGCG 
0061 GCACGGGCCT GACCTTCGCC TCCCACTCGC AACGTCCCGA ATCGGCGATC AGTCAGGTGG 
0121 CATCCACCGC CCACCTGGAC GTGCCCTCGG CCGCCTCCAG CGGCAGCG-G GGGCAG-TGC 
0181 -AGTCAGTGG GGGAAGCGGC GGAGCTCCGG AATCCGCGGG TCGATTTGTG TCCCCGCTGC 
0241 AGCGCCGCCA CTGCCAGCCG CCCAGCCACC TGCCGCTGAA CTCGGTGGCC TCCCCGCTCC 
0301 GCACCGCCAG CTACAAGTCG GCGGCGGCGG TCGCTGGTCA TGGCTTCCAC CACAGCCATC 
0361 ACCAGCAGCT GGACTTCCAG CGGAACTCGC AGTCGGACGA CGACAGCGGC TGTGCCCTCG 
0421 AGGAGTACAC TTGGGTGCCG CCGGGTCTGC GGCCCGATCA GGTCCGTTTG TACTTCAGTC 
0481 AACTGCCAGA CGACAAAGTG CCCT 
 Assemble Data

12833R-1.IR_full       1   GCCCATGCAGCAGCTACCACACGCAAACCGAAAGCGAGCTGCTGCAGATTGAGGCGGGCG 60
                           ||||| ||||||||||| ||||||||||||||||||||||||||||||||||||||||||
12833R-1.in silico     1   GCCCA-GCAGCAGCTACTACACGCAAACCGAAAGCGAGCTGCTGCAGATTGAGGCGGGCG 60


12833R-1.IR_full       61  GCACGGGCCTGACCTTCGCCTCCCACTCGCAACGTCCCGAATCGGCGATCAGTCAGGTGG 120
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
12833R-1.in silico     61  GCACGGGCCTGACCTTCGCCTCCCACTCGCAACGTCCCGAATCGGCGATCAGTCAGGTGG 120


12833R-1.IR_full       121 CATCCACCGCCCACCTGGACGTGCCCTCGGCCGCCTCCAGCGGCAGCGNGGGGCAGTTGC 180
                           |||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |||
12833R-1.in silico     121 CATCCACCGCCCACCTGGACGTGCCCTCGGCCGCCTCCAGCGGCAGCG-GGGGCAG-TGC 180


12833R-1.IR_full       181 TAGTCAGTGGGGGAAGCGGCGGAGCTCCGGAATCCGCGGGTCGATTTGTGTCCCCGCTGC 240
                            |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
12833R-1.in silico     181 -AGTCAGTGGGGGAAGCGGCGGAGCTCCGGAATCCGCGGGTCGATTTGTGTCCCCGCTGC 240


12833R-1.IR_full       241 AGCGCCGCCACTGCCAGCCGCCCAGCCACCTGCCGCTGAACTCGGTGGCCTCCCCGCTCC 300
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
12833R-1.in silico     241 AGCGCCGCCACTGCCAGCCGCCCAGCCACCTGCCGCTGAACTCGGTGGCCTCCCCGCTCC 300


12833R-1.IR_full       301 GCACCGCCAGCTACAAGTCGGCGGCGGCGGTCGNTGGTCATGGCTTCCACCACAGCCATC 360
                           ||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||
12833R-1.in silico     301 GCACCGCCAGCTACAAGTCGGCGGCGGCGGTCGCTGGTCATGGCTTCCACCACAGCCATC 360


12833R-1.IR_full       361 ACCAGCAGCTGGACTTCCAGCGGAACTCGCAGTCGGACGACGACAGCGGCTGTGCCCTCG 420
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
12833R-1.in silico     361 ACCAGCAGCTGGACTTCCAGCGGAACTCGCAGTCGGACGACGACAGCGGCTGTGCCCTCG 420


12833R-1.IR_full       421 AGGAGTACACTTGGGTGCCGCCGGGTCTGCGGCCCGATCAGGTCCGTTTGTACTTCAGTC 480
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
12833R-1.in silico     421 AGGAGTACACTTGGGTGCCGCCGGGTCTGCGGCCCGATCAGGTCCGTTTGTACTTCAGTC 480


12833R-1.IR_full       481 AACTGCCAGACGACAAAGTGCCCT 504
                           ||||||||||||||||||||||||
12833R-1.in silico     481 AACTGCCAGACGACAAAGTGCCCT 504

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_080251.2  CG12833-RB, transcript variant B (esn), mRNA 
100   482  NM_165507.1  CG12833-RA, transcript variant A (esn), mRNA 
0.41   NM_001038712.1  CG33978-RA (CG33978), mRNA 
0.2   NM_080162.3  CG9900-RB, transcript variant B (mit(1)15), mRNA 
0.2   NM_001038739.1  CG9900-RC, transcript variant C (mit(1)15), mRNA 
0   29  51  NM_165512.1  CG11084-RC, transcript variant C (pk), mRNA 
0   29  48  NM_165508.1  CG11084-RA, transcript variant A (pk), mRNA 
0   29  48  NM_165509.1  CG11084-RB, transcript variant B (pk), mRNA 
0   NM_137712.3  CG30389-RC, transcript variant C (CG30389), mRNA 
0   NM_137711.3  CG30389-RA, transcript variant A (CG30389), mRNA 
0   NM_166428.2  CG30389-RB, transcript variant B (CG30389), mRNA 
0   NM_001014503.1  CG8715-RD, transcript variant D (lig), mRNA 
0   NM_165586.2  CG8715-RB, transcript variant B (lig), mRNA 
0   NM_136504.3  CG8715-RA, transcript variant A (lig), mRNA 
0   NM_206056.2  CG8715-RC, transcript variant C (lig), mRNA 
0   NM_131924.2  CG4857-RB (CG4857), mRNA 
0   13  NM_057646.2  CG10844-RD, transcript variant D (Rya-r44F), mRNA 
0   13  NM_057645.2  CG10844-RC, transcript variant C (Rya-r44F), mRNA 
0   13  NM_057644.2  CG10844-RB, transcript variant B (Rya-r44F), mRNA 
0   13  NM_057643.2  CG10844-RA, transcript variant A (Rya-r44F), mRNA 
0   NM_169145.1  CG15186-RB, transcript variant B (CG15186), mRNA 
0   NM_206436.1  CG15186-RC, transcript variant C (CG15186), mRNA 
0   NM_141402.1  CG15186-RA, transcript variant A (CG15186), mRNA 
0   NM_135409.1  CG9468-RA (CG9468), mRNA 
0   NM_079470.2  CG10564-RA (Ac78C), mRNA 
0   NM_135156.2  CG13991-RA (CG13991), mRNA 
0   NM_137703.1  CG15655-RA (CG15655), mRNA 
0   NM_142481.1  CG7698-RA (CG7698), mRNA 
0   NM_141252.2  CG1124-RA (CG1124), mRNA 
0   NM_137297.1  CG8303-RA (CG8303), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.