National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 12802R-3 
 Symbol CG34360  Full Name
 CG No CG34360  Old CG No CG12802 
 Synonyms FBgn0085389, CG12802, BcDNA:RE66512, CG33975, CG11676, CG32469, BcDNA:RH63124, CG12804, CG12805, CG34360 
 Accession No (Link to NCBI) NM_141703.1 
 Inserted Chr. lll 
 Insertional Mutation  lethal 
 Phenotype induced by Act5C-GAL4 at 28 degrees viable 
 Map Viewer
 Reference
[Please submit your publication]
 
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgCACTTTTGTGGTGCCCGGCGA 
 Primer Seq. 3'
aatctagaggtaccAGGATGTGCCCACTCACCTCA 
 Predicted Fragment Size
417 
 IR fragment full Seq
0001 CACTTTTGTG GTGCCCGGCG AGGCACCGAN TTAATGCCGA TACGCGCTAC CTGGTCCGTT 
0061 TCGATTTCAA GACCGCCGTC GAGTCCCCAA CCGCTACCAC GTCGTCCGCG GCCTCGACCT 
0121 CGTCCACATC CTCCACAGAT CCGTCGGTCA TCGTGGAAAC GCGTCgCGCT GCCAACGTAC 
0181 ACATCAGTCC CGCTCAGGCA CTGCGTCGCA GCGCCATGAT CAAGGAGTTC CGCGAGTCGG 
0241 ATCTTATTGG ACCCGGATTC CGGTCCATCA TGGACACCGA ACTGCAGCCT GGCCAGCGGG 
0301 TCTACTTCAC CTACAATGGA CGCGAGCAGA GCGGCGATGT CGTCAAACAC GACGCTACCA 
0361 AGGATGAGGT GATTGTCAAG ATCACAACAG TTGGAAATGA GGTGAGTGGG CACATCCT 
 in silico PCR Fragment
0001 CACTTTTGTG GTGCCCGGCG AGGCACCGA- TTAATGCCGA TACGCGCTAC CTGGTCCGTT 
0061 TCGATTTCAA GACCGCCGTC GAGTCCCCAA CCGCTACCAC GTCGTCCGCG GCCTCGACCT 
0121 CGTCCACATC CTCCACAGAT CCGTCGGTCA TCGTGGAAAC GCGTCGCGCT GCCAACGTAC 
0181 ACATCAGTCC CGCTCAGGCA CTGCGTCGCA GCGCCATGAT CAAGGAGTTC CGCGAGTCGG 
0241 ATCTTATTGG ACCCGGATTC CGGTCCATCA TGGACACCGA ACTGCAGCCT GGCCAGCGGG 
0301 TCTACTTCAC CTACAATGGA CGCGAGCAGA GCGGCGATGT CGTCAAACAC GACGCTACCA 
0361 AGGATGAGGT GATTGTCAAG ATCACAACAG TTGGAAATGA GGTGAGTGGG CACATCCT 
 Assemble Data

12802R-3.IR_full       1   CACTTTTGTGGTGCCCGGCGAGGCACCGANTTAATGCCGATACGCGCTACCTGGTCCGTT 60
                           ||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||
12802R-3.in silico     1   CACTTTTGTGGTGCCCGGCGAGGCACCGA-TTAATGCCGATACGCGCTACCTGGTCCGTT 60


12802R-3.IR_full       61  TCGATTTCAAGACCGCCGTCGAGTCCCCAACCGCTACCACGTCGTCCGCGGCCTCGACCT 120
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
12802R-3.in silico     61  TCGATTTCAAGACCGCCGTCGAGTCCCCAACCGCTACCACGTCGTCCGCGGCCTCGACCT 120


12802R-3.IR_full       121 CGTCCACATCCTCCACAGATCCGTCGGTCATCGTGGAAACGCGTCGCGCTGCCAACGTAC 180
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
12802R-3.in silico     121 CGTCCACATCCTCCACAGATCCGTCGGTCATCGTGGAAACGCGTCGCGCTGCCAACGTAC 180


12802R-3.IR_full       181 ACATCAGTCCCGCTCAGGCACTGCGTCGCAGCGCCATGATCAAGGAGTTCCGCGAGTCGG 240
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
12802R-3.in silico     181 ACATCAGTCCCGCTCAGGCACTGCGTCGCAGCGCCATGATCAAGGAGTTCCGCGAGTCGG 240


12802R-3.IR_full       241 ATCTTATTGGACCCGGATTCCGGTCCATCATGGACACCGAACTGCAGCCTGGCCAGCGGG 300
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
12802R-3.in silico     241 ATCTTATTGGACCCGGATTCCGGTCCATCATGGACACCGAACTGCAGCCTGGCCAGCGGG 300


12802R-3.IR_full       301 TCTACTTCACCTACAATGGACGCGAGCAGAGCGGCGATGTCGTCAAACACGACGCTACCA 360
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
12802R-3.in silico     301 TCTACTTCACCTACAATGGACGCGAGCAGAGCGGCGATGTCGTCAAACACGACGCTACCA 360


12802R-3.IR_full       361 AGGATGAGGTGATTGTCAAGATCACAACAGTTGGAAATGAGGTGAGTGGGCACATCCT 418
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
12802R-3.in silico     361 AGGATGAGGTGATTGTCAAGATCACAACAGTTGGAAATGAGGTGAGTGGGCACATCCT 418

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   399  NM_141703.1  CG12802-RA (CG12802), mRNA 
0.5   NM_142072.2  CG9922-RA (CG9922), mRNA 
0   NM_168546.1  CG10732-RA, transcript variant A (CG10732), mRNA 
0   NM_138011.2  CG3803-RA (CG3803), mRNA 
0   NM_079016.3  CG8523-RA (Mdr50), mRNA 
0   NM_166415.1  CG3216-RB, transcript variant B (CG3216), mRNA 
0   NM_137688.1  CG3216-RA, transcript variant A (CG3216), mRNA 
0   NM_001038895.1  CG33966-RA (CG33966), mRNA 
0   NM_080342.2  CG1787-RA (Hexo2), mRNA 
0   NM_169833.1  CG7717-RB, transcript variant B (Mekk1), mRNA 
0   NM_142493.2  CG7717-RA, transcript variant A (Mekk1), mRNA 
0   NM_137806.2  CG5465-RA (MED16), mRNA 
0   NM_080307.1  CG3206-RA (Or2a), mRNA 
0   NR_001647.1  CG3206-RA (Or2a), mRNA, snRNA 
0   23  NM_001032053.1  CG33715-RB, transcript variant B (Msp-300), mRNA 
0   23  NM_001032051.1  CG33715-RD, transcript variant D (Msp-300), mRNA 
0   NM_142463.2  CG7678-RA (CG7678), mRNA 
0   NM_167654.1  CG3400-RF, transcript variant F (Pfrx), mRNA 
0   NM_167651.1  CG3400-RA, transcript variant A (Pfrx), mRNA 
0   NM_167653.1  CG3400-RE, transcript variant E (Pfrx), mRNA 
0   NM_167656.1  CG3400-RI, transcript variant I (Pfrx), mRNA 
0   NM_058104.4  CG3400-RB, transcript variant B (Pfrx), mRNA 
0   NM_167655.1  CG3400-RH, transcript variant H (Pfrx), mRNA 
0   NM_167652.1  CG3400-RD, transcript variant D (Pfrx), mRNA 
0   NM_058103.2  CG3400-RG, transcript variant G (Pfrx), mRNA 
0   NM_135111.1  CG11029-RA (CG11029), mRNA 
0   NM_139361.1  CG12090-RB, transcript variant B (CG12090), mRNA 
0   NM_167888.1  CG12090-RC, transcript variant C (CG12090), mRNA 
0   NM_167889.1  CG12090-RA, transcript variant A (CG12090), mRNA 
0   11  NM_144331.1  CG12508-RA (CG12508), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.