National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 12796Ra-1 
 Symbol mAChR-C  Full Name muscarinic Acetylcholine Receptor, C-type 
 CG No CG12796  Old CG No CG12796 
 Synonyms CG12796,mAChR-C,muscarinic Acetylcholine Receptor C-type 
 Accession No (Link to NCBI) NM_132130.1 
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees viable 
 Map Viewer
 Reference
[Please submit your publication]
 
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgCTGCTGTGGCTAGCCATCAAT 
 Primer Seq. 3'
aatctagaggtaccACAAAACCCGGCGTTATCACT 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 NTGCTGTGGC TAGCCATCAA TGCCTTCTTG TTTGTCCTTA TCCTGGGCGG CAATATTCTG 
0061 ACCATTGTGG CGGTGCGCAC CTGCCGCCAC CTGCGATCGG TCATCTCCAA TCTGTTCATC 
0121 CTGTCGCTGG CCGTCTCCGA CTTCTGTGTG GGACTGGCAC TGCCCTATCA TCTGGTATTT 
0181 TACATGGGCT CGGACATTGG CGCCATGAGA GGTCCCTGCC TGCTGCGCTT CTTCCTGCTC 
0241 ATCTGCGCCT GCTGCGTGTC CATGCTGACT CTGATCTCGA TTGCGGTGGA TCGGTATATA 
0301 GCAGTCGTCT ATGCTCTGCA CTATAGAAGG TAAGGTATTA AGCGAACNNN ATAAATCCTA 
0361 ATTCAATGGC TACATATGAG AAACCCTTTG AAACCGTAGA TACATGACCC GTCGAGTGGC 
0421 ATATAGCATC ATCATATTCA ATTGGTGCTT GGGTGCATTG GTGGCTCTGC TGCCAGTGTT 
0481 CTGGAATCGA TGGCCGGATG CACAGGCGTG CGAATTCGAC GAAGTTCTCG CGCCTGGTTA 
0541 CATTGCCGGA GTGATAACGC CGGGTTTTGT  
 in silico PCR Fragment
0001 CTGCTGTGGC TAGCCATCAA TGCCTTCTTG TTTGTCCTTA TCCTGGGCGG CAATATTCTG 
0061 ACCATTGTGG CGGTGCGCAC CTGCCGCCAC CTGCGATCGG TCATCTCCAA TCTGTTCATC 
0121 CTGTCGCTGG CCGTCTCCGA CTTCTGTGTG GGACTGGCAC TGCCCTATCA TCTGGTATTT 
0181 TACATGGGCT CGGACATTGG CGCCATGAGA GGTCCCTGCC TGCTGCGCTT CTTCCTGCTC 
0241 ATCTGCGCCT GCTGCGTGTC CATGTTGACT CTGATCTCGA TTGCGGTGGA TCGGTATATA 
0301 GCAGTCGTCT ATGCTCTGCA CTATAGAAGA TACATGACCC GTCGAGTGGC ATATAGCATC 
0361 ATCATATTCA ATTGGTGCTT GGGTGCATTG GTGGCTCTGC TGCCAGTGTT CTGGAATCGA 
0421 TGGCCGGATG CACAGGCGTG CGAATTCGAC GAAGTTCTCG CGCCTGGTTA CATTGCCGGA 
0481 GTGATAACGC CGGGTTTTGT  
 Assemble Data

12796Ra-1.IR full        1   TGCTGTGGCTAGCCATCAATGCCTTCTTGTTTGTCCTTATCCTGGGCGGCAATATTCTG 59
                             |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
12796Ra-1.in silico      1   TGCTGTGGCTAGCCATCAATGCCTTCTTGTTTGTCCTTATCCTGGGCGGCAATATTCTG 59


12796Ra-1.IR full       61  ACCATTGTGGCGGTGCGCACCTGCCGCCACCTGCGATCGGTCATCTCCAATCTGTTCATC 119
                            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
12796Ra-1.in silico     61  ACCATTGTGGCGGTGCGCACCTGCCGCCACCTGCGATCGGTCATCTCCAATCTGTTCATC 119


12796Ra-1.IR full       121 CTGTCGCTGGCCGTCTCCGACTTCTGTGTGGGACTGGCACTGCCCTATCATCTGGTATTT 179
                            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
12796Ra-1.in silico     121 CTGTCGCTGGCCGTCTCCGACTTCTGTGTGGGACTGGCACTGCCCTATCATCTGGTATTT 179


12796Ra-1.IR full       181 TACATGGGCTCGGACATTGGCGCCATGAGAGGTCCCTGCCTGCTGCGCTTCTTCCTGCTC 239
                            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
12796Ra-1.in silico     181 TACATGGGCTCGGACATTGGCGCCATGAGAGGTCCCTGCCTGCTGCGCTTCTTCCTGCTC 239


12796Ra-1.IR full       241 ATCTGCGCCTGCTGCGTGTCCATGCTGACTCTGATCTCGATTGCGGTGGATCGGTATATA 299
                            |||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||
12796Ra-1.in silico     241 ATCTGCGCCTGCTGCGTGTCCATGTTGACTCTGATCTCGATTGCGGTGGATCGGTATATA 299


12796Ra-1.IR full       301 GCAGTCGTCTATGCTCTGCACTATAGAAGGTAAGGTATTAAGCGAACNNNATAAATCCTA 359
                            |||||||||||||||||||||||||||||                               
12796Ra-1.in silico     301 GCAGTCGTCTATGCTCTGCACTATAGAAG------------------------------- 359


12796Ra-1.IR full       361 ATTCAATGGCTACATATGAGAAACCCTTTGAAACCGTAGATACATGACCCGTCGAGTGGC 419
                                                                   |||||||||||||||||||||
12796Ra-1.in silico     361 ---------------------------------------ATACATGACCCGTCGAGTGGC 419


12796Ra-1.IR full       421 ATATAGCATCATCATATTCAATTGGTGCTTGGGTGCATTGGTGGCTCTGCTGCCAGTGTT 479
                            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
12796Ra-1.in silico     421 ATATAGCATCATCATATTCAATTGGTGCTTGGGTGCATTGGTGGCTCTGCTGCCAGTGTT 479


12796Ra-1.IR full       481 CTGGAATCGATGGCCGGATGCACAGGCGTGCGAATTCGACGAAGTTCTCGCGCCTGGTTA 539
                            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
12796Ra-1.in silico     481 CTGGAATCGATGGCCGGATGCACAGGCGTGCGAATTCGACGAAGTTCTCGCGCCTGGTTA 539


12796Ra-1.IR full       541 CATTGCCGGAGTGATAACGCCGGGTTTTGT 569
                            ||||||||||||||||||||||||||||||
12796Ra-1.in silico     541 CATTGCCGGAGTGATAACGCCGGGTTTTGT 569

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_132130.1  CG12796-RA (CG12796), mRNA 
0.2   NM_139522.1  CG14964-RA (CG14964), mRNA 
0.2   NM_057938.3  CG3093-RA (dor), mRNA 
0   NM_079674.2  CG16740-RA (Rh2), mRNA 
0   NM_138056.1  CG30418-RA (nord), mRNA 
0   NM_142248.2  CG31183-RA (CG31183), mRNA 
0   NM_132816.2  CG7872-RA (CG7872), mRNA 
0   NM_001014621.1  CG8651-RE, transcript variant E (trx), mRNA 
0   NM_134282.1  CG8651-RA, transcript variant A (trx), mRNA 
0   NM_057422.2  CG8651-RB, transcript variant B (trx), mRNA 
0   NM_057421.2  CG8651-RD, transcript variant D (trx), mRNA 
0   NM_134281.1  CG8651-RC, transcript variant C (trx), mRNA 
0   NM_206635.2  CG3869-RB, transcript variant B (Marf), mRNA 
0   NM_206634.1  CG3869-RC, transcript variant C (Marf), mRNA 
0   NM_132092.2  CG3869-RA, transcript variant A (Marf), mRNA 
0   NM_164568.1  CG31773-RA (CG31773), mRNA 
0   NM_080299.2  CG18531-RA (Gr2a), mRNA 
0   NM_135764.3  CG5287-RA (CG5287), mRNA 
0   NM_001043235.1  CG12814-RB, transcript variant B (CG12814), mRNA 
0   NM_141727.2  CG12814-RA, transcript variant A (CG12814), mRNA 
0   NM_057702.4  CG4479-RA (Mst35Ba), mRNA 
0   NM_057703.3  CG4478-RA (Mst35Bb), mRNA 
0   NM_079331.2  CG11280-RA (trn), mRNA 
0   NM_169774.1  CG31249-RA (CG31249), mRNA 
0   NM_132370.1  CG2989-RA (CG2989), mRNA 
0   NM_079751.3  CG31136-RA (Syx1A), mRNA 
0   NM_080315.2  CG10742-RA (Tsp3A), mRNA 
0   NM_136391.2  CG9436-RA (CG9436), mRNA 
0   NM_134754.2  CG5565-RA (CG5565), mRNA 
0   NM_137624.1  CG9090-RA (CG9090), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.