National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 12788R-2 
 Symbol CG12788  Full Name CG12788 
 CG No CG12788  Old CG No CG12788 
 Synonyms CG33066, CG12788 
 Accession No (Link to NCBI)  
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees early pupal lethal 
 Map Viewer
 Reference
[Please submit your publication]
 
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgCTAGAGGTGCCAGACACTTCG 
 Primer Seq. 3'
aatctagaggtaccTAGTAATCCAAGGCGTCGCCC 
 Predicted Fragment Size
377 
 IR fragment full Seq
0001 CTAGAGGTGC CAGACACTTC GGAAGCCTGG GAACGCAACA GTCTCACACT TAATGGCCTC 
0061 GATATGGATA CCACGGGATC TGCGTTGCTT GCTTTTATTG CATCTCTGCT CGATTTGCCC 
0121 GCAATGGAGA CGACGTTGGA CTTGCCACCG GCGGTAGCAA GAGGACTACG ACAAGATCAG 
0181 TCTCTGGTGC ACCGCCTGGA TTTGCTCCTG CGGACGCGCA TTGGGGCGTT GCTCGATGGA 
0241 CTGAGACAAG GGGAGGACAA GCGCTTGGCG GGCCAAACAC TGAACAGTAG GCGCAAGGAT 
0301 ATATTGACCA AATTCCGCAC AGAGATCGGC GGCAAACAGA TAGACGGCGA TGTTGAGGGC 
0361 GACGCNTTGG ATTACTA 
 in silico PCR Fragment
0001 CTAGAGGTGC CAGACACTTC GGAAGCCTGG GAACGCAACA GTCTCACACT TAATGGCCTC 
0061 GATATGGATA CCACGGGATC TGCGTTGCTT GCTTTTATTG CATCTCTGCT CGATTTGCCC 
0121 GCAATGGAGA CGACGTTGGA CTTGCCACCG GCGGTAGCAA GAGGACTACG ACAAGATCAG 
0181 TCTCTGGTGC ACCGCCTGGA TTTGCTCCTG CGGACGCGCA TTGGGGCGTT GCTCGATGGA 
0241 CTGAGACAAG GGGAGGACAA GCGCTTGGCG GGCCAAACAC TGAACAGTAG GCGCAAGGAT 
0301 ATATTGACCA AATTCCGCAC AGAGATCGGC GGCAAACAGA TAGACGGCGA TGTTGAGGGC 
0361 GACGCCTTGG ATTACTA 
 Assemble Data

12788R-2.IR full       1   CTAGAGGTGCCAGACACTTCGGAAGCCTGGGAACGCAACAGTCTCACACTTAATGGCCTC 60
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
12788R-2.in silico     1   CTAGAGGTGCCAGACACTTCGGAAGCCTGGGAACGCAACAGTCTCACACTTAATGGCCTC 60


12788R-2.IR full       61  GATATGGATACCACGGGATCTGCGTTGCTTGCTTTTATTGCATCTCTGCTCGATTTGCCC 120
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
12788R-2.in silico     61  GATATGGATACCACGGGATCTGCGTTGCTTGCTTTTATTGCATCTCTGCTCGATTTGCCC 120


12788R-2.IR full       121 GCAATGGAGACGACGTTGGACTTGCCACCGGCGGTAGCAAGAGGACTACGACAAGATCAG 180
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
12788R-2.in silico     121 GCAATGGAGACGACGTTGGACTTGCCACCGGCGGTAGCAAGAGGACTACGACAAGATCAG 180


12788R-2.IR full       181 TCTCTGGTGCACCGCCTGGATTTGCTCCTGCGGACGCGCATTGGGGCGTTGCTCGATGGA 240
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
12788R-2.in silico     181 TCTCTGGTGCACCGCCTGGATTTGCTCCTGCGGACGCGCATTGGGGCGTTGCTCGATGGA 240


12788R-2.IR full       241 CTGAGACAAGGGGAGGACAAGCGCTTGGCGGGCCAAACACTGAACAGTAGGCGCAAGGAT 300
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
12788R-2.in silico     241 CTGAGACAAGGGGAGGACAAGCGCTTGGCGGGCCAAACACTGAACAGTAGGCGCAAGGAT 300


12788R-2.IR full       301 ATATTGACCAAATTCCGCACAGAGATCGGCGGCAAACAGATAGACGGCGATGTTGAGGGC 360
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
12788R-2.in silico     301 ATATTGACCAAATTCCGCACAGAGATCGGCGGCAAACAGATAGACGGCGATGTTGAGGGC 360


12788R-2.IR full       361 GACGCNTTGGATTACTA 377
                           ||||| |||||||||||
12788R-2.in silico     361 GACGCCTTGGATTACTA 377

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.