National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock discarded request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 12753R-5 
 Symbol CG12753  Full Name CG12753 
 CG No CG12753  Old CG No CG12753 
 Synonyms CG12753 
 Accession No (Link to NCBI) NM_142285.1 
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees viable 
 Map Viewer
 Reference
[Please submit your publication]
 
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgCACCTTAAGTACCTGTACAGC 
 Primer Seq. 3'
aatctagaggtaccGCAATTCTCACCATTGACTCG 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 CACCTTAAGT ACCTGTACAG CATTCTGGAG AAGAACACCA CCGTGTCGNA AAGTAATCGT 
0061 GGCCTGCTGG TGGAGTCGCT GCGCTGCATC GCAGAGNATC CTGATTTGGG GCGACCAGCA 
0121 TGACTCGCTG GTGTTTGACT TCTTCTTGGA GAAGAATATG CTATCGTATT TCCTGCACAT 
0181 AATGCGACAA AAGAGTGGAG GCTCGAGTTT CGTCTGCGTG CAGCTCCTTC AGACTCTCAA 
0241 CATCCTCTTT GAGAACATAC GCAACGAGAC GTCCCTGTAT TATCTGTTGA GCAACAACCA 
0301 TGTAAATTCT ATCATGGTGC ACAAGTTTGA CTTCTCCGAC GAGGATGTGA TGGGCTATTA 
0361 TATACTTTTT TTAAAGACGC TAAGTCTAAA GTTAAACACT CACACAATAC ACTTCTTTTA 
0421 CAATGAGCAC ACAAATGACT TTCCCTTGTA TACAGAGGCT ATTAAGTTCT TTAATCATCC 
0481 CGAGTCAATG GTGAGAANTG C 
 in silico PCR Fragment
0001 CACCTTAAGT ACCTGTACAG CATTCTGGAG AAGAACACCA CCGTGTCGGA AAGTAATCGT 
0061 GGCCTGCTGG TGGAGTCGCT GCGCTGCATC GCAGAG-ATC CTGATTTGGG GCGACCAGCA 
0121 TGACTCGCTG GTGTTTGACT TCTTCTTGGA GAAGAATATG CTATCGTATT TCCTGCACAT 
0181 AATGCGACAA AAGAGTGGAG GCTCGAGTTT CGTCTGCGTG CAGCTCCTTC AGACTCTCAA 
0241 CATCCTCTTT GAGAACATAC GCAACGAGAC GTCCCTGTAT TATCTGTTGA GCAACAACCA 
0301 TGTAAATTCT ATCATGGTGC ACAAGTTTGA CTTCTCCGAC GAGGATGTGA TGGGCTATTA 
0361 TATACTTTTT TTAAAGACGC TAAGTCTAAA GTTAAACACT CACACAATAC ACTTCTTTTA 
0421 CAATGAGCAC ACAAATGACT TTCCCTTGTA TACAGAGGCT ATTAAGTTCT TTAATCATCC 
0481 CGAGTCAATG GTGAGAATTG C 
 Assemble Data

12753R-5.IR_full       1   CACCTTAAGTACCTGTACAGCATTCTGGAGAAGAACACCACCGTGTCGNAAAGTAATCGT 60
                           |||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||
12753R-5.in silico     1   CACCTTAAGTACCTGTACAGCATTCTGGAGAAGAACACCACCGTGTCGGAAAGTAATCGT 60


12753R-5.IR_full       61  GGCCTGCTGGTGGAGTCGCTGCGCTGCATCGCAGAGNATCCTGATTTGGGGCGACCAGCA 120
                           |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||
12753R-5.in silico     61  GGCCTGCTGGTGGAGTCGCTGCGCTGCATCGCAGAG-ATCCTGATTTGGGGCGACCAGCA 120


12753R-5.IR_full       121 TGACTCGCTGGTGTTTGACTTCTTCTTGGAGAAGAATATGCTATCGTATTTCCTGCACAT 180
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
12753R-5.in silico     121 TGACTCGCTGGTGTTTGACTTCTTCTTGGAGAAGAATATGCTATCGTATTTCCTGCACAT 180


12753R-5.IR_full       181 AATGCGACAAAAGAGTGGAGGCTCGAGTTTCGTCTGCGTGCAGCTCCTTCAGACTCTCAA 240
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
12753R-5.in silico     181 AATGCGACAAAAGAGTGGAGGCTCGAGTTTCGTCTGCGTGCAGCTCCTTCAGACTCTCAA 240


12753R-5.IR_full       241 CATCCTCTTTGAGAACATACGCAACGAGACGTCCCTGTATTATCTGTTGAGCAACAACCA 300
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
12753R-5.in silico     241 CATCCTCTTTGAGAACATACGCAACGAGACGTCCCTGTATTATCTGTTGAGCAACAACCA 300


12753R-5.IR_full       301 TGTAAATTCTATCATGGTGCACAAGTTTGACTTCTCCGACGAGGATGTGATGGGCTATTA 360
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
12753R-5.in silico     301 TGTAAATTCTATCATGGTGCACAAGTTTGACTTCTCCGACGAGGATGTGATGGGCTATTA 360


12753R-5.IR_full       361 TATACTTTTTTTAAAGACGCTAAGTCTAAAGTTAAACACTCACACAATACACTTCTTTTA 420
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
12753R-5.in silico     361 TATACTTTTTTTAAAGACGCTAAGTCTAAAGTTAAACACTCACACAATACACTTCTTTTA 420


12753R-5.IR_full       421 CAATGAGCACACAAATGACTTTCCCTTGTATACAGAGGCTATTAAGTTCTTTAATCATCC 480
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
12753R-5.in silico     421 CAATGAGCACACAAATGACTTTCCCTTGTATACAGAGGCTATTAAGTTCTTTAATCATCC 480


12753R-5.IR_full       481 CGAGTCAATGGTGAGAANTGC 501
                           ||||||||||||||||| |||
12753R-5.in silico     481 CGAGTCAATGGTGAGAATTGC 501

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_001038969.1  CG12753-RB, transcript variant B (CG12753), mRNA 
100   482  NM_142285.1  CG12753-RA, transcript variant A (CG12753), mRNA 
0   NM_057825.3  CG2928-RA (Reg-5), mRNA 
0   NM_143614.1  CG1499-RA, transcript variant A (CG1499), mRNA 
0   NM_170552.1  CG1499-RB, transcript variant B (CG1499), mRNA 
0   NM_135091.2  CG31989-RA (Cap-D3), mRNA 
0   NM_176544.1  CG33193-RA (sav), mRNA 
0   10  NM_057377.3  CG9949-RA, transcript variant A (sina), mRNA 
0   NM_080536.2  CG4013-RA, transcript variant A (Smr), mRNA 
0   NM_167334.1  CG4013-RB, transcript variant B (Smr), mRNA 
0   NM_167335.1  CG4013-RC, transcript variant C (Smr), mRNA 
0   NM_079669.2  CG7665-RA, transcript variant A (Fsh), mRNA 
0   NM_169777.1  CG7665-RB, transcript variant B (Fsh), mRNA 
0   NM_078831.1  CG5006-RA (Or33c), mRNA 
0   NM_140498.1  CG7003-RA (CG7003), mRNA 
0   NM_057353.3  CG9668-RA (Rh4), mRNA 
0   NM_136603.1  CG11778-RA (CG11778), mRNA 
0   NM_168474.1  CG32087-RA (CG32087), mRNA 
0   NM_164555.1  CG31959-RB (CG31959), mRNA 
0   NM_132584.2  CG32654-RC (CG32654), mRNA 
0   NM_135313.2  CG14534-RA (CG14534), mRNA 
0   10  NM_057531.3  CG6863-RA, transcript variant A (tok), mRNA 
0   10  NM_170168.1  CG6863-RB, transcript variant B (tok), mRNA 
0   NM_079751.3  CG31136-RA (Syx1A), mRNA 
0   NM_169871.1  CG6184-RC, transcript variant C (CG6184), mRNA 
0   NM_142567.1  CG6184-RA, transcript variant A (CG6184), mRNA 
0   NM_169870.1  CG6184-RB, transcript variant B (CG6184), mRNA 
0   NM_137721.1  CG18375-RA, transcript variant A (CG18375), mRNA 
0   NM_176243.1  CG18375-RB, transcript variant B (CG18375), mRNA 
0   NM_058119.3  CG18783-RA, transcript variant A (Kr-h1), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.